ID: 929034526

View in Genome Browser
Species Human (GRCh38)
Location 2:37678009-37678031
Sequence GGGAGTTCCAAGTACTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929034526_929034534 11 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034534 2:37678043-37678065 TGAACAGGTTGGAGCCAGAGGGG 0: 1
1: 0
2: 3
3: 15
4: 201
929034526_929034531 0 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034531 2:37678032-37678054 TGGCTACTGACTGAACAGGTTGG 0: 1
1: 0
2: 33
3: 399
4: 752
929034526_929034537 16 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034537 2:37678048-37678070 AGGTTGGAGCCAGAGGGGAGGGG 0: 1
1: 0
2: 8
3: 74
4: 562
929034526_929034528 -4 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034528 2:37678028-37678050 TCCCTGGCTACTGACTGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 172
929034526_929034535 14 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034535 2:37678046-37678068 ACAGGTTGGAGCCAGAGGGGAGG 0: 1
1: 0
2: 0
3: 42
4: 350
929034526_929034532 9 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034532 2:37678041-37678063 ACTGAACAGGTTGGAGCCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 192
929034526_929034533 10 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034533 2:37678042-37678064 CTGAACAGGTTGGAGCCAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 195
929034526_929034536 15 Left 929034526 2:37678009-37678031 CCTTGAGAGTACTTGGAACTCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 929034536 2:37678047-37678069 CAGGTTGGAGCCAGAGGGGAGGG 0: 1
1: 1
2: 6
3: 52
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929034526 Original CRISPR GGGAGTTCCAAGTACTCTCA AGG (reversed) Intronic
901358722 1:8676715-8676737 GGGAGTTCCAACCACCCACAGGG + Intronic
903153188 1:21427861-21427883 GGCAGTTCCAGGTACCCACAGGG + Intergenic
903159944 1:21480124-21480146 GGCAGTTCCAGGTACTCAAAAGG - Exonic
905322029 1:37124667-37124689 GGGAGAACCCAGAACTCTCACGG - Intergenic
909541377 1:76795506-76795528 AGGAGTTCCAAAGACCCTCAGGG + Intergenic
911548527 1:99251241-99251263 AGGAGTCCCAAGTAGTATCAAGG - Intergenic
912616837 1:111110385-111110407 GGGTGATCCATGTACTCCCATGG + Intergenic
912815668 1:112826148-112826170 AGGAGATCCAAGAACTCTCTTGG - Intergenic
915751427 1:158213956-158213978 GGCAGTTCCAGGTACTGGCATGG - Intergenic
918335372 1:183505509-183505531 GGCAGTTACATTTACTCTCATGG + Intronic
919062936 1:192657325-192657347 GGGAGGACCAAGTATTCTCAAGG - Intronic
919861381 1:201741112-201741134 GGGAGCCCCAAGTACCCTCCAGG + Intronic
1065443835 10:25777033-25777055 GGGAGTTACAAGTCCTCTCCAGG + Intergenic
1075280276 10:121132938-121132960 GGGAGTTTCAATTAGCCTCAGGG - Intergenic
1078255207 11:9652990-9653012 GGGAATTCTAAGAAGTCTCATGG - Intergenic
1080796503 11:35568343-35568365 GGGTGATGCAAGCACTCTCATGG - Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083838874 11:65291547-65291569 AGGAGTTCCAACCACTCTCCAGG - Intronic
1085651028 11:78268822-78268844 GGGAATTCCAAATCCTCTGAAGG - Intronic
1086209625 11:84302997-84303019 TGTAGTTCCAGGTACTCACAAGG + Intronic
1086447909 11:86887525-86887547 GGGTGTTCCATGTGCTCACAGGG - Intronic
1087208051 11:95417773-95417795 GGGAGTTTAAAGTAATCTCCAGG - Intergenic
1088411384 11:109538720-109538742 AGGATTTCCAAGTACTCAAAGGG + Intergenic
1090622778 11:128576147-128576169 GGGAGTTGCCAGGGCTCTCAAGG + Intronic
1093567607 12:20626943-20626965 GTGAGTTCCAAGAACTCTAATGG + Intronic
1096604460 12:52754712-52754734 GGGAGTTCCATGGACACACATGG - Intergenic
1099879801 12:88454574-88454596 GTAAGTGCCAAGTACTCCCACGG + Intergenic
1101969819 12:109305119-109305141 GGTGGTTACAAATACTCTCAGGG + Intronic
1102212490 12:111137633-111137655 TGGAGTTCCAACTACTCTGGAGG - Intronic
1106916287 13:34518803-34518825 TGGAGTCCCAACTACTCTGAAGG - Intergenic
1107578439 13:41753179-41753201 GGGAGTTCCCAGGTCTCCCAGGG - Intronic
1113510567 13:110851069-110851091 CTGAGTTCCAAGCAGTCTCAAGG - Intergenic
1115098106 14:29663964-29663986 TGAATTTCCAAATACTCTCAAGG - Intronic
1116965134 14:51006791-51006813 GAGAATACCAAGTATTCTCAGGG - Intronic
1121628953 14:95408806-95408828 AGCAGTTCCAATTCCTCTCATGG - Intronic
1124549973 15:30671193-30671215 GGCAGTACCAAGTGCTGTCAAGG + Intronic
1127033943 15:54894717-54894739 AGGCGTTCCAGGTATTCTCAGGG + Intergenic
1127551261 15:60040781-60040803 GGGAGTTCATAGTTCACTCAGGG - Intronic
1129515656 15:76155508-76155530 TAGAGTTCCACGGACTCTCAGGG - Intronic
1130736456 15:86555300-86555322 GGGAGGTCCAGGTATTCTTAGGG - Intronic
1138390938 16:56669528-56669550 GGGAGTAGCAGGTAATCTCAGGG + Intronic
1142318739 16:89367231-89367253 GGGAGTTCAGCGTTCTCTCAGGG + Intronic
1143056062 17:4162647-4162669 GGCAGTAGGAAGTACTCTCAAGG - Intronic
1149231281 17:54537138-54537160 GAGAGTACCAAGTACACTCTTGG + Intergenic
1150276281 17:63899791-63899813 GCGACTTCCCAGTACTGTCAGGG - Intergenic
1156399167 18:36725172-36725194 GCAAGTTCCAAGAACTCTCAGGG - Intronic
1157432862 18:47644007-47644029 GGGAGATGCAGGTACACTCATGG + Intergenic
1161265404 19:3361266-3361288 GGGACTTCCACGGCCTCTCAGGG - Intronic
1162621970 19:11850661-11850683 GTGAGATCCAAGAACTCTCTTGG - Intronic
1162626808 19:11891057-11891079 GTGAGATCCAAGAACTCTCTTGG - Intronic
925749273 2:7073013-7073035 TAGAGTTCCAAGGAGTCTCATGG - Intergenic
926881557 2:17550589-17550611 GGAAGTCCCAGTTACTCTCATGG - Intronic
927036080 2:19177843-19177865 GGGAGTCCCAAGTTATCTTAGGG + Intergenic
927916668 2:26941536-26941558 GAGAGTCCATAGTACTCTCATGG + Intronic
929034526 2:37678009-37678031 GGGAGTTCCAAGTACTCTCAAGG - Intronic
930540203 2:52696670-52696692 CAGAGTTCCAAGTACTTACAAGG + Intergenic
930555185 2:52886311-52886333 GAGAGTTCAAGGTGCTCTCAGGG - Intergenic
930708860 2:54531021-54531043 GGGGCTTCCATGTCCTCTCAGGG - Intronic
930884828 2:56313809-56313831 AGGAGTACCAGGTACTCACAGGG + Intronic
935596986 2:104886539-104886561 GCGAGATCCAAGAACTCTCTCGG - Intergenic
942984275 2:182120652-182120674 GGGTGTCTCAAATACTCTCAAGG - Intronic
948285970 2:236785555-236785577 GAGAGTTCCAAAGACTATCAAGG - Intergenic
948674437 2:239588728-239588750 AGGAGCCCCAAGTACTCACACGG - Intergenic
1169763387 20:9121188-9121210 GTGAATTCCAAGTGCTCTCTGGG - Intronic
1177736116 21:25092528-25092550 GGGAGTTCCAGGTCCTCGCTGGG + Intergenic
1178041520 21:28645121-28645143 GGGAGTTCCAGATACACACAGGG + Intergenic
1178255278 21:31046587-31046609 GGGGTTTCCAAGTACTGTAAGGG - Intergenic
1178592772 21:33925354-33925376 TGTAGTTCCAAGTACTCTGGAGG - Intergenic
1179928331 21:44550627-44550649 GGGAGGTCCAAGGACTGGCAGGG + Exonic
1179939349 21:44628092-44628114 GGGAGGTCCAAGGACTGGCAGGG - Exonic
1183373326 22:37448101-37448123 GAGGTTTCCAAGTCCTCTCAGGG + Intergenic
1183554660 22:38515873-38515895 GTGAGGTCCAAGAACTCTCTCGG + Intergenic
955515714 3:59724569-59724591 GGGATATCCAAATATTCTCAAGG - Intergenic
956013694 3:64858720-64858742 GGGAGTACCAAGTACAATGAGGG + Intergenic
958807339 3:98827572-98827594 GGAAGTTCAAAGAGCTCTCAAGG + Intronic
965586165 3:170319992-170320014 GCGAGATCCAAGAACTCTCTCGG - Intergenic
966143646 3:176785971-176785993 GGAAGTTCCCAGTCCTCTGAAGG + Intergenic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
979390765 4:120124921-120124943 TGGAGTGTCAAGTACTCTCTGGG + Intergenic
980136428 4:128862762-128862784 GGGAATTCCCAGTACTGTCATGG + Intronic
981644194 4:146979947-146979969 GAGTGTTCCTAATACTCTCAGGG + Intergenic
985029941 4:185779485-185779507 GTGATTTCCAAGGACTTTCATGG + Intronic
997284267 5:132667362-132667384 GCGAGATCCAAGAACTCTCTCGG + Intergenic
998146738 5:139733498-139733520 GGGAGTTCCAGATGCTCACAGGG - Intergenic
1001033931 5:168283335-168283357 GGGAATTCTCAGTGCTCTCAGGG - Intergenic
1001441064 5:171743419-171743441 GGGGGCTCAAATTACTCTCATGG - Intergenic
1011554329 6:88558813-88558835 AGGAGTTGCAAGGCCTCTCAGGG + Intergenic
1014119409 6:117706071-117706093 GGGAATTCCAAATAGTATCAGGG - Intronic
1014707121 6:124761306-124761328 GGGAGGGCCAAGTACTTTGAAGG - Intronic
1015646404 6:135393977-135393999 GTAAGTTCCAAATACTTTCAAGG + Intronic
1015722117 6:136253370-136253392 GGCTGTTCCAATTACTTTCAGGG + Intergenic
1016770868 6:147849067-147849089 GAGAATTCCAAGTTCTCTAAAGG - Intergenic
1017273989 6:152544379-152544401 AGGAGTTCCAAATACTCTCTGGG + Intronic
1022133441 7:27425207-27425229 GGGAGTTCCCTGTACTCTTCTGG + Intergenic
1022552515 7:31254703-31254725 GAGAGTTCCCAGAACTGTCACGG - Intergenic
1023534822 7:41197102-41197124 GGGAGCCCCAGTTACTCTCAGGG - Intergenic
1023889937 7:44384813-44384835 CTGTGTTCCAAGTACTCACAGGG - Exonic
1028488383 7:91384726-91384748 GGAAGTTCCACCTAATCTCATGG - Intergenic
1030228960 7:107185090-107185112 GGGAGCTCCATATACTCTAAAGG + Intronic
1036571762 8:9985878-9985900 TGCAGTTCCAACTACTCTGAAGG - Intergenic
1037946896 8:22995338-22995360 GGGAGTTCTCAGTACAATCAAGG + Intronic
1038015322 8:23509777-23509799 GAGAGATCAAAGTACTCTCAGGG - Intergenic
1038626196 8:29195584-29195606 GGAAGTTCCAAGTAACTTCATGG + Intronic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1043061055 8:75503870-75503892 GGAAGTTCCAGGTAATCTAAAGG + Intronic
1044954995 8:97470811-97470833 GGGAGTTTTAACTGCTCTCATGG - Intergenic
1048827043 8:138438313-138438335 GAGAGTTCCAGGAACTCTCATGG - Intronic
1055013564 9:71592475-71592497 GGGGGTTTTAAGTACTCCCATGG + Intergenic
1055931671 9:81565670-81565692 GGGTGTTCCCAGTGATCTCAAGG + Intergenic
1056236036 9:84595526-84595548 CAGAGTTCCCAGTCCTCTCAGGG - Intergenic
1059788679 9:117616136-117616158 TGAAGTTCCAAGTACTGCCAGGG + Intergenic
1194174011 X:90624742-90624764 GGCAATTCCAAGTACAGTCATGG - Intergenic
1194592340 X:95814875-95814897 ATGAGTTCCCATTACTCTCAAGG - Intergenic
1194984527 X:100476281-100476303 AGGAGTGCCAAGTATTCTCCTGG + Intergenic
1194997865 X:100611389-100611411 GCGAGATCCAAGAACTCTCTTGG + Intergenic
1200166577 X:154039703-154039725 GGGTGTTCTAAGTACACTGAGGG - Intronic
1200246235 X:154527518-154527540 GAGAGTTTTAAGTACTCTCTGGG + Intergenic
1200325287 X:155231446-155231468 GGGAGTGCTAAGTACTTTGAAGG - Intronic