ID: 929035234

View in Genome Browser
Species Human (GRCh38)
Location 2:37684525-37684547
Sequence AGTAAACTTTAGTAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929035234 Original CRISPR AGTAAACTTTAGTAGGTGAA TGG Intronic
902164389 1:14558283-14558305 AGCAAAATTTAGAAGGTAAATGG + Intergenic
905496510 1:38393129-38393151 AGTATACTTTTGAAAGTGAAAGG - Intergenic
906133456 1:43476980-43477002 AGGAAACTTTTGTAGGTGATGGG - Intergenic
906304522 1:44708353-44708375 AGAAGAGTTTAGTAGGTGACAGG + Intronic
908087875 1:60655768-60655790 AGGAACCTTTAGTAGATGAGAGG - Intergenic
908415302 1:63907596-63907618 AGTGAACTTTAGAAGTAGAAGGG - Intronic
908588106 1:65596597-65596619 AGTATATTTTAGTAAGTAAAAGG + Intronic
908783597 1:67713815-67713837 AGTAAACATTTGTATGTGCAAGG - Intronic
909003844 1:70252677-70252699 TTTAAACTTTAGTAGATAAAAGG + Exonic
909304370 1:74054127-74054149 AATATACTTTAGTAGGTGAATGG + Intronic
909642632 1:77885183-77885205 AGTGAAGCTGAGTAGGTGAAGGG - Intergenic
909688353 1:78376624-78376646 AGTAAAATTTAGTAGGTCTGTGG + Intronic
910615891 1:89198099-89198121 AGTAAACAGTACTAGGTGCAGGG + Intronic
911270025 1:95790064-95790086 AGAAAAATGAAGTAGGTGAAGGG + Intergenic
912095723 1:106140447-106140469 AGTAACCTTTAATAGGTGAATGG + Intergenic
912984570 1:114414495-114414517 AGTAAATTTTATTAGGAAAAAGG - Intronic
914441820 1:147714370-147714392 AATATCCTTGAGTAGGTGAAAGG - Intergenic
915388243 1:155516885-155516907 AATAAATTTAAGGAGGTGAAAGG + Intronic
915573466 1:156759214-156759236 TGCAAACTTTAGGAGGTAAAAGG + Intronic
915613958 1:157020173-157020195 AGGAAACTTTTGGAGGTGATGGG + Intronic
916281232 1:163053656-163053678 AGTAAACATTAATAGGCAAAAGG - Intergenic
916432034 1:164739526-164739548 AGTAAAATTGCGTAGGTCAATGG - Intronic
917856005 1:179100492-179100514 CATAAACTTTAGTTGGAGAATGG - Exonic
919239803 1:194898640-194898662 AGTCATCTTTAGTATGTAAAAGG - Intergenic
919250580 1:195051426-195051448 AGTGAACTTTAAGGGGTGAATGG + Intergenic
921127710 1:212192387-212192409 AGACATCTTCAGTAGGTGAATGG + Intergenic
923735028 1:236598461-236598483 AGTGAACTTTAGTAGGTGAGTGG + Intronic
924204071 1:241693162-241693184 AGAAATCTTCAGTAGCTGAATGG + Intronic
1064153465 10:12884794-12884816 AATATACTTTAGAAGGTGACAGG - Intergenic
1070418445 10:76212112-76212134 AGTCAACATTTGTAGGTTAATGG - Intronic
1071034655 10:81230587-81230609 AGGAAACTTTTGGAGGTGATAGG - Intergenic
1071816262 10:89235127-89235149 AGTAATCTCTAGTAGATGGAGGG + Intronic
1071890967 10:90006644-90006666 AATAGAATTTTGTAGGTGAAAGG + Intergenic
1072322176 10:94261391-94261413 GATATACTTCAGTAGGTGAATGG - Intronic
1072363329 10:94682688-94682710 AGTAGAATTTATTAAGTGAAAGG + Intergenic
1072383955 10:94904734-94904756 AGTAGAATTTATTAAGTGAAAGG + Intergenic
1072622009 10:97086203-97086225 AATGGCCTTTAGTAGGTGAATGG + Intronic
1073903550 10:108250605-108250627 AGTAGAATTTACTAAGTGAAAGG - Intergenic
1074166890 10:110887961-110887983 AGGAAATTTTAGTAGATGGAAGG + Intronic
1079775472 11:24520540-24520562 ATTAAACTTTAGCAAGGGAAAGG + Intronic
1080369097 11:31613397-31613419 AGTATACATTAGTATTTGAAAGG + Intronic
1082981682 11:59129980-59130002 AGTAAACGCTAGTAGGAGGATGG - Intergenic
1085698545 11:78726498-78726520 AATAATCTTTAGTATGTGATGGG + Intronic
1086437751 11:86799383-86799405 AGTAGACTTTGATAGGAGAAAGG + Intronic
1087097692 11:94335583-94335605 AATGTCCTTTAGTAGGTGAATGG - Intergenic
1087563973 11:99829989-99830011 AGTAAACTTAATTAAGTGTAGGG + Intronic
1090347970 11:126086240-126086262 AGTAAACACTAGTAGGAGAGTGG + Intergenic
1090617537 11:128529222-128529244 ATTAAACTTGAGAAGGTGAAAGG - Intronic
1090873396 11:130767605-130767627 AGTAGATTTTATTAAGTGAAAGG - Intergenic
1091609475 12:1992650-1992672 AGTAAAATGTAGTATGAGAAAGG + Intronic
1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG + Intergenic
1094046591 12:26174406-26174428 AGAAAATTTTAGAAGGTGATGGG - Intronic
1094716662 12:33020906-33020928 AGTAGAATTTATTAAGTGAAAGG + Intergenic
1095224292 12:39661045-39661067 AGCATACTTCAGTAGATGAACGG - Intronic
1096307062 12:50487077-50487099 AGCAACATTCAGTAGGTGAATGG + Intergenic
1097476896 12:60069092-60069114 AGTAAACTGTTCTAGGAGAAAGG + Intergenic
1097985949 12:65783323-65783345 TGTAAACTTTAGTGGGTCATGGG - Intergenic
1098317069 12:69203988-69204010 AGGAAACTTTTTTAGGTGATGGG + Intergenic
1098503801 12:71226120-71226142 AGTATACTTTAGGATGTGTATGG - Intronic
1100046030 12:90382247-90382269 AGTAACCTTTAGAATGTGAAAGG - Intergenic
1100263446 12:92954048-92954070 AGTAGAATTTATTAAGTGAAAGG + Intergenic
1101588670 12:106107543-106107565 GGTAAACTTTCCTAGGGGAAAGG + Intronic
1101715070 12:107303634-107303656 CTTAAACTTTTGTAAGTGAAGGG + Intergenic
1102449314 12:113029064-113029086 ATTAAACATTACTAGGTGGAAGG - Intergenic
1104421147 12:128636494-128636516 AGTAAACTTTGGGAGGTGACGGG - Intronic
1104482152 12:129117008-129117030 GATATCCTTTAGTAGGTGAATGG + Intronic
1107029584 13:35837117-35837139 ATAAAACTTTAGGTGGTGAATGG + Intronic
1108055786 13:46483651-46483673 GGTAAACATAAGTAGGTGTATGG + Intergenic
1110956959 13:81564868-81564890 AATGACCTTTATTAGGTGAATGG - Intergenic
1111753674 13:92365315-92365337 AGTAAAATATAGTAGATAAAAGG + Intronic
1113281629 13:108794781-108794803 AGTAAACTAGAATAGGAGAAGGG + Intronic
1120308968 14:82806091-82806113 AAGAAACTTTAGAGGGTGAAAGG + Intergenic
1126432201 15:48598113-48598135 TGTAAACCTTCGTAAGTGAAGGG + Intronic
1127064641 15:55223825-55223847 TATAAACATTAGCAGGTGAATGG - Intronic
1127845967 15:62871281-62871303 TGTAAACTTTATAAGGGGAAGGG + Intergenic
1128057624 15:64712261-64712283 GGTATCCTTCAGTAGGTGAATGG + Intergenic
1131690996 15:94827293-94827315 AGTAAAGTTTAGTGAGTGATTGG - Intergenic
1133571700 16:7047102-7047124 AGTAAATGTTAATAGGTGACTGG - Intronic
1137551751 16:49442184-49442206 AGTTACCTCTAGGAGGTGAAAGG - Intergenic
1137660302 16:50199758-50199780 AATGACCTTCAGTAGGTGAATGG - Intronic
1138181221 16:54941413-54941435 AGAAAAATTTAGTAGGGTAAGGG + Intergenic
1139381547 16:66535578-66535600 AGAAAACTAAAGCAGGTGAAAGG - Intronic
1140895296 16:79319342-79319364 AGTAAACTTTAGAAGTTCTATGG + Intergenic
1145853367 17:28126294-28126316 ATTACAATTTAGTAGGTGCAAGG - Intronic
1148387692 17:47246639-47246661 GATATCCTTTAGTAGGTGAATGG + Intergenic
1148596525 17:48860495-48860517 ACAAAAATTTAGTAGGGGAAAGG - Intronic
1153663128 18:7343404-7343426 AGTAAACTCAAGTAGTTAAAGGG - Intergenic
1153925000 18:9827837-9827859 AGTAAACATTAATAGCTCAAAGG - Intronic
1156417016 18:36906073-36906095 AGTTAACTTTAAAAAGTGAATGG - Intronic
1156928508 18:42612373-42612395 AGTTAACTTTCCTAGGTTAATGG + Intergenic
1157262910 18:46192037-46192059 ACTATCCTTCAGTAGGTGAATGG - Intronic
1158671658 18:59479814-59479836 CTTAAAGTTTAGCAGGTGAAAGG + Intronic
1159906236 18:74095159-74095181 AGAAAGCTTTAGTTGTTGAATGG - Intronic
1164912278 19:32022556-32022578 AATAAACTTTAGTAAGTGCAAGG - Intergenic
1167758549 19:51428383-51428405 AGTAGAATTTATTAAGTGAAAGG - Intergenic
926070709 2:9887300-9887322 AGTAAAAATTAGTATTTGAATGG - Intronic
926665607 2:15519148-15519170 AGTAAATGTTAATGGGTGAAAGG - Intronic
928878721 2:36072410-36072432 AGTTAACTTGAGTACGTTAAAGG + Intergenic
929035234 2:37684525-37684547 AGTAAACTTTAGTAGGTGAATGG + Intronic
929697439 2:44131079-44131101 GGGAAACTTTGGTAGGGGAAGGG + Intergenic
929900274 2:45994676-45994698 AATGTCCTTTAGTAGGTGAACGG - Intronic
930439262 2:51386070-51386092 TGTCAACTTAAGTGGGTGAAAGG - Intergenic
930568215 2:53049871-53049893 AGTATCCTTCAGCAGGTGAATGG + Intergenic
932058748 2:68473392-68473414 GATGACCTTTAGTAGGTGAATGG - Intronic
932510688 2:72286245-72286267 GGTATCCTTCAGTAGGTGAATGG + Intronic
933056668 2:77679382-77679404 AGTAGAATTTATTAAGTGAAAGG + Intergenic
933103303 2:78287694-78287716 AGTAAAATTTATTAAGCGAAAGG - Intergenic
933229893 2:79794516-79794538 AGGAAACTTTGGAAGGTGATGGG - Intronic
933352595 2:81173950-81173972 GATACCCTTTAGTAGGTGAATGG - Intergenic
933359683 2:81265040-81265062 GATATTCTTTAGTAGGTGAATGG - Intergenic
933538753 2:83611470-83611492 AGTAATATTTAGAAGATGAAGGG - Intergenic
933926800 2:87100524-87100546 AGTAGAATTTATTAAGTGAAAGG + Intergenic
935377480 2:102414070-102414092 AGTAGAATTTATTAAGTGAAAGG - Intergenic
935500606 2:103833875-103833897 AGTTTGCTTTAATAGGTGAAAGG + Intergenic
935567375 2:104623409-104623431 AGAAAACTTCAGTAGATGATTGG - Intergenic
935633242 2:105229626-105229648 ACTACCCTTCAGTAGGTGAATGG + Intergenic
936834324 2:116689085-116689107 AGTAGAATTTATTAAGTGAAAGG + Intergenic
939172276 2:138709904-138709926 AATATCCTTCAGTAGGTGAATGG - Intronic
939534395 2:143408834-143408856 AGAAAATTTTATTAGCTGAATGG - Intronic
940376864 2:152967494-152967516 AGTACACTTCAGTATGTGGATGG - Intergenic
941199362 2:162490390-162490412 AGTAGAATTTATTAAGTGAAAGG - Intronic
941641097 2:167989266-167989288 AATAAACTTCATTTGGTGAATGG + Intronic
942232355 2:173872423-173872445 AGTGAAATTTAGTAGATGAGGGG - Intergenic
942844564 2:180407345-180407367 AGAAATCTTTAGCAGGGGAATGG - Intergenic
943205842 2:184894220-184894242 ATTAAGCTTTACTCGGTGAAGGG + Intronic
943580342 2:189676352-189676374 ATTAATCTTATGTAGGTGAAAGG + Intronic
944111420 2:196135254-196135276 AGTAAAGTTTAGTAAGTCATTGG - Exonic
944938932 2:204601783-204601805 AGTAATCTTGAGTAGTTCAAAGG + Intronic
945140117 2:206676819-206676841 AGGAAACTTTAGGAGGTGATGGG + Intronic
945620942 2:212136311-212136333 AGTAAACATTAGCTGATGAAAGG - Intronic
946106212 2:217372218-217372240 AGTCCACTTTAGTAGGTGCCAGG - Intronic
946605872 2:221403599-221403621 AGAAAAGTTTAGCCGGTGAAAGG + Intergenic
946972392 2:225109074-225109096 AATAAACATTTGTAGATGAAAGG - Intergenic
1171303807 20:24087283-24087305 AATGTTCTTTAGTAGGTGAATGG - Intergenic
1171508426 20:25658858-25658880 AGTAAACTGTAGTATCTAAAAGG - Intergenic
1173175412 20:40761217-40761239 AGCAACCTTCAGTAGGTGAATGG - Intergenic
1173697721 20:45034340-45034362 AATAAACTGCAGTAGGGGAAAGG + Intronic
1174915328 20:54647684-54647706 AGTAACCTTTCTTAGGGGAAAGG - Intronic
1181884292 22:26007464-26007486 AGTAAACTTTACCAGGTGAGTGG - Intronic
1183766382 22:39879864-39879886 GGTAACGTTCAGTAGGTGAATGG + Intronic
1185334362 22:50265020-50265042 AGTGAGCTCTAGGAGGTGAAGGG + Exonic
952065810 3:29568696-29568718 AGAAAACTGTTGTAGTTGAAAGG - Intronic
953306040 3:41830471-41830493 AGGAAACTTTTGGAGGTGATAGG + Intronic
953349750 3:42206538-42206560 AGGAAACTTGAGTACGGGAAGGG - Intronic
955733377 3:62010966-62010988 AGTAGAATTTATTAAGTGAAAGG + Intronic
955734098 3:62018398-62018420 AGTAAACTTTAGAAGGGAAACGG - Intronic
957173919 3:76779291-76779313 AGGAAACTTTGGGAGGTGACGGG - Intronic
958763209 3:98333075-98333097 AGGGAACTTTAGTGGGTAAAAGG - Intergenic
959339875 3:105115343-105115365 AATAAACTTTAGGAGGTGGAAGG - Intergenic
960766703 3:121138191-121138213 AATAAATTTAAGGAGGTGAAAGG + Intronic
964672143 3:159238442-159238464 AAGAAACTTTAGTAGCTTAATGG - Intronic
965143317 3:164866519-164866541 AATAAATTTTAGCAGGTGGAAGG - Intergenic
965410612 3:168326153-168326175 AGTAAAGTTTTATTGGTGAAGGG - Intergenic
965756956 3:172037506-172037528 AGCAAACTTCAGAATGTGAAAGG - Intergenic
967290124 3:187911435-187911457 ACTAAATTTTAATAGATGAATGG + Intergenic
967595442 3:191322609-191322631 AGAAAACTATAATAGCTGAAGGG + Intronic
969926308 4:10589139-10589161 AGGAAACTTTTGGAGGTGATGGG + Intronic
971574994 4:28261781-28261803 AGTTAATTCTAGTAGTTGAAAGG - Intergenic
973082940 4:46017182-46017204 AGATAACTTTAGTTGGAGAAAGG - Intergenic
973202346 4:47518826-47518848 AGTAAACTCTAGTATTTGAGAGG + Intronic
975491470 4:74993792-74993814 AGAAAACCTTTGTAGGTGATGGG + Intronic
975626311 4:76352020-76352042 CGTAACTTTTAGTATGTGAAGGG + Intronic
975836358 4:78426279-78426301 TGAAAGCTTGAGTAGGTGAAGGG + Intronic
976060149 4:81118228-81118250 AGTATCCGTCAGTAGGTGAATGG - Intronic
976096299 4:81511908-81511930 ATTAAACTTTAGTTTGAGAAAGG + Intronic
976347302 4:84019200-84019222 AGGAAGCATTAGTAGGTGAATGG - Intergenic
976461865 4:85320993-85321015 AGTAGAATTTATTAAGTGAAAGG + Intergenic
977336268 4:95703535-95703557 AGTATCCATCAGTAGGTGAATGG - Intergenic
978071295 4:104474906-104474928 AATAAAATTGAGTAGCTGAAAGG - Intronic
979120890 4:116899630-116899652 TGTCAACTTGAGTAGGTCAAAGG + Intergenic
979688396 4:123536914-123536936 AGTTAATTTTAGCAGGTGAATGG - Intergenic
981257454 4:142679042-142679064 AATAAACTGAAGTAGATGAAAGG - Intronic
981947835 4:150370285-150370307 GATATATTTTAGTAGGTGAATGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983764083 4:171454259-171454281 AGCAACCTTTAGCAGCTGAATGG - Intergenic
984011002 4:174371455-174371477 CCTAAACTATACTAGGTGAATGG + Intergenic
985106835 4:186508313-186508335 AGAAAACTTCAGTAGATCAAAGG + Intronic
986240701 5:5957262-5957284 AGTAGAATTTACTAAGTGAAAGG + Intergenic
986719199 5:10548196-10548218 AGAAAACTTTTGGAGGTGACGGG + Intergenic
987235953 5:15941885-15941907 AGTAAAATTCAGTGGTTGAAGGG - Intergenic
989541559 5:42624619-42624641 AGGAAATTTTTGTAGGTGATAGG - Intronic
989596299 5:43159242-43159264 AGTATAGTATAGTAGATGAAAGG - Intronic
990253714 5:53943252-53943274 ATGTAACTTCAGTAGGTGAAAGG + Intronic
990329023 5:54707112-54707134 AGGAAACTTTAGTAAAGGAATGG - Intergenic
991580312 5:68147944-68147966 AGTATATTTTAGTGGGTCAATGG - Intergenic
992316038 5:75555897-75555919 AGTAAACTTTAGTAGGTAAATGG - Intronic
992466082 5:77006369-77006391 AGAATATTTAAGTAGGTGAAAGG - Intergenic
995899888 5:117053100-117053122 AGAAAACTTTAGGTGGTGATAGG + Intergenic
998482013 5:142470455-142470477 AGCAAACTTTGTTAGGTGAGTGG + Intergenic
998526567 5:142848072-142848094 GGCAAGCTTTAGTTGGTGAAGGG + Intronic
999045513 5:148464828-148464850 AGAAATTTTTAGTAGGTGAATGG + Intronic
1000382654 5:160642924-160642946 AGAAACCTTGAGTAGGTGATGGG - Intronic
1005238107 6:23789967-23789989 AGTAACGTTAAGTAGCTGAAAGG - Intergenic
1005449492 6:25959065-25959087 AGTAGAATTTATTAAGTGAAAGG - Intergenic
1008634247 6:53393820-53393842 AGGAAACTTTTGGAGGTGATGGG + Intergenic
1008839199 6:55879220-55879242 AGGAAACTTTAGAAGGTTAGGGG - Intergenic
1009484269 6:64199928-64199950 AGTGTCCCTTAGTAGGTGAATGG + Intronic
1010080736 6:71857971-71857993 AATATCCTTTAATAGGTGAATGG - Intergenic
1012163439 6:95917767-95917789 GATTAACTTTAGTCGGTGAACGG + Intergenic
1012891448 6:104902105-104902127 CATATTCTTTAGTAGGTGAATGG - Intergenic
1013437385 6:110124381-110124403 AGTAGAATTTATTAAGTGAAAGG - Intronic
1014539652 6:122659520-122659542 AGTAAACTTAACTTAGTGAAAGG + Intronic
1015564783 6:134557923-134557945 TATATACTTTAGCAGGTGAAGGG + Intergenic
1021103618 7:16611973-16611995 AGTAAAATTTATTAAGTGAAAGG - Intronic
1021874491 7:25036023-25036045 AGTAGAATTTATTAAGTGAAAGG + Intergenic
1024062184 7:45707285-45707307 GGTATCCTTCAGTAGGTGAATGG + Intronic
1024221415 7:47290933-47290955 AATGTCCTTTAGTAGGTGAATGG + Intronic
1024461848 7:49667600-49667622 AGTAATGTTTATAAGGTGAATGG + Intergenic
1026413500 7:70153458-70153480 AGTAAACTTTTGTAGGTGATGGG + Intronic
1027781527 7:82526491-82526513 AATAAACTTTAGTATTTGAAAGG + Intergenic
1028857574 7:95608901-95608923 GGGGAAGTTTAGTAGGTGAAGGG + Intergenic
1030565764 7:111153283-111153305 AATTAACTTTAGTAGGTATAAGG - Intronic
1030967374 7:116009327-116009349 AGTTGACTTTAGTATGTGCATGG - Intronic
1031413950 7:121473489-121473511 AGTAAACTCTAATATTTGAAAGG + Intergenic
1031430277 7:121659500-121659522 AGAAACCTTCAGTAGGTGAATGG - Intergenic
1031668189 7:124511561-124511583 GATATACTTCAGTAGGTGAATGG + Intergenic
1032804090 7:135338845-135338867 AGTGAACTTCAGCATGTGAAGGG - Intergenic
1032812813 7:135439380-135439402 AGTATAATTTAGTATGTGACAGG - Intronic
1033053875 7:138031616-138031638 ATGAACCTTTAGTGGGTGAATGG - Intronic
1033705153 7:143879402-143879424 AGTAAAGTTTAATATTTGAAAGG + Intronic
1033846748 7:145442816-145442838 AGGACACTTCCGTAGGTGAAGGG - Intergenic
1038902831 8:31863348-31863370 AGTAAGTTTTATTAGGGGAAGGG + Intronic
1041544328 8:59025050-59025072 AGAAAATCTTAGTAGGTAAACGG + Intronic
1042488093 8:69368684-69368706 AGTAAACTTCAGCAGGTAAAGGG + Intergenic
1044132933 8:88549021-88549043 AGTAGAATTTATTAAGTGAAAGG + Intergenic
1044203568 8:89464977-89464999 AATATACTTTGCTAGGTGAAAGG + Intergenic
1046244620 8:111542938-111542960 AGTAAACTTTAATGGATGCAAGG - Intergenic
1047908563 8:129500372-129500394 AGTAAATTTTACAAGTTGAAAGG - Intergenic
1048586402 8:135778099-135778121 AGATGACGTTAGTAGGTGAATGG - Intergenic
1048994185 8:139781261-139781283 AGCAACCTTCAGTAGGTGAATGG + Intronic
1049832694 8:144712537-144712559 AGTGGACTTTAGTAGGCTAATGG + Intergenic
1050065784 9:1758170-1758192 AGTAAGCTGTAGTAGGGGGATGG - Intergenic
1050160129 9:2710180-2710202 ACTAAACTTTTGAAGGTCAATGG + Intergenic
1052259431 9:26495203-26495225 TGTAAACTTTAAAAGTTGAAAGG + Intergenic
1055005591 9:71502290-71502312 GATATCCTTTAGTAGGTGAATGG + Intergenic
1055062789 9:72088021-72088043 ATTCACCTTTAGTAGGTGAATGG - Intergenic
1055190159 9:73510045-73510067 AATAAACTGTAGAAGGTCAAAGG + Intergenic
1055634692 9:78264944-78264966 AGTTATGTTTTGTAGGTGAACGG + Intronic
1056037295 9:82619961-82619983 AGGAAACTTTAGGAGGTGATGGG + Intergenic
1056040641 9:82662284-82662306 AGAAAATTTTAGTGGTTGAAAGG + Intergenic
1057246086 9:93455133-93455155 AGTATCCTTTAATAAGTGAATGG + Intronic
1059089719 9:111342869-111342891 GATGACCTTTAGTAGGTGAATGG + Intergenic
1061771617 9:132928178-132928200 AGTATCCTTCAGTAGGTGAATGG - Intronic
1186938501 X:14477539-14477561 ACTAAACTATAGCAGCTGAAAGG - Intergenic
1188471644 X:30547052-30547074 ACTAAACTTTTGTATGAGAAAGG + Intergenic
1188637954 X:32459199-32459221 AGGAAACTTTTGGAGGTGATAGG + Intronic
1191959578 X:66685524-66685546 AGGAAACTTTTGAAGGTGATGGG + Intergenic
1192550546 X:72049854-72049876 AGTAAACATGTGTAAGTGAAAGG - Intergenic
1192919267 X:75689066-75689088 AATATCCTTCAGTAGGTGAAGGG - Intergenic
1193134245 X:77952089-77952111 GATACCCTTTAGTAGGTGAATGG - Intronic
1193744071 X:85254037-85254059 AGTGTCCTTTAGCAGGTGAATGG - Intronic
1194566653 X:95496989-95497011 GGTAAAATTTAGTAAGTCAAAGG + Intergenic
1195372750 X:104196277-104196299 AGTTAACTGTTGTAGGTGATTGG + Intergenic
1195974153 X:110507710-110507732 CCAAAACTTCAGTAGGTGAATGG + Intergenic
1196257773 X:113542377-113542399 AATATACTTCAGTAGGAGAAAGG + Intergenic
1198503049 X:137271537-137271559 ACTAAACTTTAATAGCTGAGTGG - Intergenic
1199013405 X:142783086-142783108 AGTCAACTTAAGTGGGTTAAGGG + Intergenic
1200432294 Y:3099614-3099636 AGTAAATTTTAGTTGTTGACTGG - Intergenic