ID: 929035644

View in Genome Browser
Species Human (GRCh38)
Location 2:37688874-37688896
Sequence GGCCCAAGAAACCACAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929035644 Original CRISPR GGCCCAAGAAACCACAGAAA AGG (reversed) Intronic
900885395 1:5411628-5411650 GGCCACAGAAAGGACAGAAAGGG + Intergenic
901441028 1:9278639-9278661 GGCCCAAGATGCCAGAGGAAGGG + Intergenic
901623247 1:10605997-10606019 GGTCCAAGAAACCTAAGGAAAGG - Intronic
901943744 1:12684137-12684159 TGCTCAAGAAGTCACAGAAAAGG + Intergenic
902889404 1:19431040-19431062 GACCCTAGAAACCATATAAACGG + Intronic
902892883 1:19457312-19457334 GGCCCCAGAGACTACAGACAAGG + Intronic
904950573 1:34235191-34235213 GGCCCAAGAAAGAATTGAAAAGG - Intergenic
905513782 1:38545641-38545663 GGTCCCAGAAAACCCAGAAAAGG + Intergenic
905904455 1:41608556-41608578 GAGCCAACAAAGCACAGAAAAGG - Intronic
906493133 1:46283612-46283634 GGCCTTTGAAACCACAGGAATGG + Intronic
906652935 1:47525959-47525981 AGCCCAAGAAAGCTCAGAATGGG - Intergenic
907055262 1:51360442-51360464 GGCCTATAAAATCACAGAAATGG - Intronic
907322377 1:53612762-53612784 GGACCAAGACACCAGAGAGAAGG - Intronic
907647330 1:56257401-56257423 TTCCCAAGAAACAAGAGAAATGG - Intergenic
909207710 1:72780537-72780559 GATCCTAGAAACCACAGCAAAGG + Intergenic
911366796 1:96948288-96948310 GGGACAACAAACCACAGAAAGGG - Intergenic
911620491 1:100062331-100062353 GGCCCACAAAGCCACAAAAAAGG - Intronic
913360070 1:117970639-117970661 GACCCCACAAACCACAGGAAGGG - Intronic
915025107 1:152820622-152820644 GGCCCACCATACCAGAGAAAGGG + Intergenic
916031671 1:160882276-160882298 GGCCCTAGGAACCAGAGACATGG + Intronic
916516477 1:165522570-165522592 GGTCCAAGAGACAAAAGAAATGG + Intergenic
919469051 1:197956250-197956272 GGCCCCAAAAACCACAAAAGAGG - Intergenic
919915183 1:202134582-202134604 GGCCCAAGAAACCAAACCTAAGG + Intronic
920041401 1:203100031-203100053 GGCCCAAGCCCCCACAGAAAGGG - Intronic
921131678 1:212225104-212225126 GCTCCAAGAAGCCAGAGAAAGGG + Intergenic
921741860 1:218694613-218694635 GGCCCTAGAAGCCAAGGAAAGGG - Intergenic
922539292 1:226407090-226407112 GGCTCAGGAAACCTCAGAAGGGG + Intronic
923561897 1:235047823-235047845 GGCACAAGGAGCCACAGGAAAGG + Intergenic
924385468 1:243495342-243495364 GGCCGCAGAAACCAGAGGAATGG - Intronic
924396161 1:243623526-243623548 GACCCAAAAAAGCAAAGAAAAGG + Intronic
1062972636 10:1660580-1660602 GGCCCAAGACCCCAGAAAAAGGG + Intronic
1064242958 10:13647211-13647233 GCCCCCAGAATCCACACAAAGGG + Intronic
1065713984 10:28546447-28546469 AGCCCCAATAACCACAGAAAAGG - Intronic
1067942916 10:50670971-50670993 GGCCAAAGAATCCATATAAATGG - Intergenic
1069373247 10:67768749-67768771 GCCCCTACATACCACAGAAAAGG + Intergenic
1069961726 10:72083132-72083154 AGACCAAGAAACCTGAGAAATGG - Intronic
1070864157 10:79695937-79695959 GGCCAAAGAATCCATATAAATGG - Intergenic
1071631055 10:87218163-87218185 GGCCAAAGAATCCATATAAATGG - Intergenic
1072801030 10:98392586-98392608 GGCCCCAGAAACCGCAGGAAGGG + Intronic
1074377605 10:112952034-112952056 AGCCCAAGACGCCACAGAAGAGG - Intronic
1074868878 10:117561651-117561673 GGCCCTGGAAACCACAGCTATGG + Intergenic
1075349786 10:121713487-121713509 GGCCCAAGAACCAACAGCATCGG + Intergenic
1079137839 11:17786289-17786311 GACCAAACAAACCACAGAGATGG - Intergenic
1080642882 11:34168062-34168084 TGCCCCAGAAACCACAGATCGGG + Intronic
1080708338 11:34720973-34720995 GGTCCATGAAACCAAAGGAAAGG + Intergenic
1081602845 11:44507194-44507216 ATCCCAATAAAACACAGAAAAGG + Intergenic
1082798148 11:57393549-57393571 AATCCAAGAAACCACAGGAAGGG - Intronic
1083347719 11:62005249-62005271 TGCCCGAGAACCCACAGGAATGG + Intergenic
1083805193 11:65069321-65069343 TGGCCAAGTAACCACAGACATGG + Intronic
1083958684 11:66002010-66002032 GAACCAAGAAAACACAGTAAAGG + Exonic
1084622351 11:70281545-70281567 GGGCCAAGATCCCAGAGAAAAGG - Intronic
1085195940 11:74671771-74671793 GGCCCAGGACACGAGAGAAAAGG - Intergenic
1086452742 11:86933176-86933198 GTCCAAAGGAACCACAGCAATGG - Intronic
1088353861 11:108921190-108921212 AGGCAAATAAACCACAGAAAAGG - Intronic
1090279896 11:125446620-125446642 AACACAAAAAACCACAGAAAGGG - Intronic
1090365186 11:126199631-126199653 GGCCTAAGAAAACACAGAAAAGG + Intergenic
1090775449 11:129961080-129961102 TGCCTGAGAAAACACAGAAAAGG + Exonic
1092743112 12:11649356-11649378 GGCCCCAGACACCACAAAACAGG - Intergenic
1092951465 12:13507471-13507493 GGACCAAGGAACCACAGGAGGGG + Intergenic
1096204688 12:49711172-49711194 GGACTAAGAAACCACACAAAAGG - Intronic
1096811265 12:54171854-54171876 GGCCCGAGTGACCACAGCAATGG - Intronic
1099156446 12:79182302-79182324 GTCCCAAAAAATCACAGAAAGGG - Intronic
1099715028 12:86281111-86281133 GAGCCAATAAACAACAGAAAAGG - Intronic
1100343346 12:93702657-93702679 GAGCCAAGAAAACCCAGAAAAGG - Intronic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1104408049 12:128534813-128534835 GGGAGAAGGAACCACAGAAATGG - Intronic
1104526365 12:129526778-129526800 GGCAAAAGAAAAGACAGAAAAGG - Intronic
1104567888 12:129901962-129901984 TGCACAGGAAACCAAAGAAAAGG - Intronic
1105286393 13:19008123-19008145 GGCCCCACCAACCAGAGAAAGGG - Intergenic
1105775799 13:23659032-23659054 GGCACCTGAAACCACAGGAATGG - Exonic
1106224636 13:27775658-27775680 GGCCCAAGTCACCCCAGAACTGG - Intergenic
1106996614 13:35491499-35491521 GGCCTAAGAAACCGGAAAAAAGG - Intronic
1107332026 13:39311713-39311735 AGGAAAAGAAACCACAGAAAAGG + Intergenic
1108096328 13:46905040-46905062 GGTCCTAGAAACCACTGAAATGG + Intergenic
1109688885 13:65859979-65860001 GGACTTGGAAACCACAGAAAAGG + Intergenic
1110985020 13:81956479-81956501 GGGCAAAGAATCCTCAGAAAGGG - Intergenic
1111025799 13:82521078-82521100 GACCCAAGAGACCCCAGAACTGG - Intergenic
1111839263 13:93428920-93428942 GGCCCAAGAAATCACACTATTGG + Intronic
1111979839 13:95004002-95004024 GGTCCAAGAAAACACAAACATGG + Intergenic
1112779107 13:102878596-102878618 GGCCCAAGATCCCAGAAAAAAGG - Intergenic
1114403307 14:22430260-22430282 GGGCTAAGAAAAGACAGAAAGGG + Intergenic
1115971803 14:38952965-38952987 GGCTCTGGAAACCACAGTAAGGG + Intergenic
1117280033 14:54230709-54230731 TGCACAAGAGAACACAGAAAAGG + Intergenic
1117512427 14:56466363-56466385 CTCCCAAGAAACCTGAGAAATGG + Intergenic
1117863184 14:60114767-60114789 GTCCCAAGTGCCCACAGAAAGGG - Exonic
1118553584 14:66985961-66985983 GGCACCACAAACAACAGAAAGGG + Intronic
1119230213 14:72973591-72973613 TGCCAAAGAAACCACTGAAGAGG + Intronic
1119583153 14:75805963-75805985 TGGCCAAGAAACCAGTGAAAAGG - Intronic
1119793867 14:77377918-77377940 GGCCCCCGAAACCTCAGACATGG - Exonic
1121016626 14:90552981-90553003 GGCCCAAAGAACCTCAGGAAGGG + Intronic
1121415663 14:93777726-93777748 GGCCTGAGAGAACACAGAAATGG - Intronic
1121503739 14:94460679-94460701 TGCCCATGAAAACACAGAGAGGG - Intergenic
1121539293 14:94712985-94713007 GGCCCAATAGCCCAAAGAAAGGG + Intergenic
1124477492 15:30047420-30047442 AGACCAGGAGACCACAGAAATGG - Intergenic
1125587142 15:40828883-40828905 GGCCCTAGAAGCTGCAGAAAGGG - Intergenic
1126062675 15:44798961-44798983 TGCACAAGAAACAACAGGAAAGG - Intergenic
1128806766 15:70536817-70536839 GGGCCGAGAAAACAAAGAAAGGG + Intergenic
1129756045 15:78099773-78099795 GGCCAAAGAAGCCAATGAAAAGG - Intronic
1132291344 15:100705888-100705910 GGACCAGGCAGCCACAGAAAGGG + Intergenic
1133936039 16:10270149-10270171 TGTCCAAGAAACCACTGCAATGG - Intergenic
1137002478 16:35241618-35241640 GACCCCAGCAACTACAGAAATGG + Intergenic
1139698969 16:68695542-68695564 GGCCAAAGAGACTACAGCAATGG - Intronic
1140687726 16:77449816-77449838 GGTTCTAGAAGCCACAGAAAAGG + Intergenic
1141085211 16:81089419-81089441 GGCCTATCAAAACACAGAAAAGG - Intronic
1144479029 17:15613762-15613784 GGACCCAGAAACCCCAGAACTGG + Intronic
1144919275 17:18749971-18749993 GGACCCAGAAACCCCAGAACTGG - Intronic
1145257872 17:21337483-21337505 GGCCCAGGAGACCCCAGAGAGGG - Intergenic
1147482227 17:40777252-40777274 GGCCCAGGAAATCAAACAAAAGG - Exonic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151925880 17:77196076-77196098 GGCACATGAAACCGCAGAGATGG - Intronic
1154380913 18:13849018-13849040 GACCCTAGAAAAGACAGAAATGG - Intergenic
1154460922 18:14584784-14584806 GGTTAAAGAAACCACAGATATGG + Intergenic
1157196292 18:45622796-45622818 GGCCTTAGAGACCACAGCAAAGG + Intronic
1157593141 18:48848149-48848171 GGCGGAGGAAGCCACAGAAATGG - Intronic
1158657300 18:59350001-59350023 GGCCCAAGGCACCAGAGTAAGGG + Intronic
1159834816 18:73325549-73325571 GCCCCAGGAAACCAGAGAAGGGG - Intergenic
1164824104 19:31271653-31271675 GACCTCAGAAAACACAGAAAAGG - Intergenic
1164848174 19:31452222-31452244 GGCTTAAGCAAACACAGAAAAGG + Intergenic
1165894694 19:39134510-39134532 GGCGAAAGAAAGCACAGACAAGG - Intronic
1167311050 19:48738330-48738352 GCCCCAAGAGACCACATCAAAGG + Intronic
1167659053 19:50785323-50785345 GCCCCAAAAAACCACAGCCAGGG - Intergenic
926641634 2:15244226-15244248 TGCCCAAGAAACCACAAACCTGG + Intronic
927100801 2:19786433-19786455 GTGCCAAGAAAGCACAGAAAAGG + Intergenic
928071589 2:28222782-28222804 GACACAAGACACAACAGAAAGGG - Intronic
928185016 2:29102413-29102435 GGGCAAAGAAACAACAGAGAAGG - Intronic
928898097 2:36288020-36288042 GGCCCAAGAATCAACAGATAGGG - Intergenic
928992455 2:37248382-37248404 GGCCCAAGAAATCAAAATAAAGG + Exonic
929035644 2:37688874-37688896 GGCCCAAGAAACCACAGAAAAGG - Intronic
929960709 2:46494217-46494239 GGGCCAAGAAATCATAGACAAGG - Intronic
931090187 2:58877427-58877449 GGCACGAGACATCACAGAAATGG + Intergenic
933529824 2:83493747-83493769 AGCCAAAGAAATTACAGAAAAGG + Intergenic
934859489 2:97751985-97752007 GGCCAAACAAACCACAGCATTGG + Intergenic
935732597 2:106076582-106076604 AGCCCCAGAGACCACAGACACGG + Intronic
936152635 2:110030076-110030098 GGCCAGAGGCACCACAGAAATGG + Intergenic
936192045 2:110341336-110341358 GGCCAGAGGCACCACAGAAATGG - Intergenic
936398626 2:112149311-112149333 AGCCCAAGAAACCACTGAACTGG - Intronic
936563561 2:113563473-113563495 GGACCAAGAGACCACCCAAATGG - Intergenic
939284373 2:140110131-140110153 GGCCCTGGAAACCACTGAATGGG - Intergenic
940281794 2:151996804-151996826 TGCCCAGGAAACTAAAGAAAAGG + Intronic
940808901 2:158220678-158220700 GGGCCAAGAAAAAACAGAAGTGG - Exonic
942783202 2:179670647-179670669 GGTCCAACATACCACTGAAAAGG + Intronic
943269408 2:185779208-185779230 GGACAAAGAAACCACAAATAAGG - Intronic
944281640 2:197904578-197904600 GGCACAAGAAACCCAAGAATAGG - Intronic
944546401 2:200803391-200803413 GAACAAAGAAACCAAAGAAATGG - Intergenic
944910246 2:204303877-204303899 GGCCCAAGAATGAACACAAATGG + Intergenic
944912087 2:204321054-204321076 AGCCCAAGAGAACACAGAAAAGG + Intergenic
946097371 2:217287072-217287094 GGTCAAAGGAACCACAGAAAGGG - Intronic
946162507 2:217844358-217844380 CCCCCATGAAACCACAGGAATGG + Intronic
947907451 2:233775678-233775700 GGCCCAAGCAGCCACAGCAATGG - Exonic
1170279177 20:14626437-14626459 GGTCCAGGAACCAACAGAAAAGG + Intronic
1172072306 20:32267077-32267099 CTCCAAAGAAACTACAGAAATGG - Intergenic
1172283359 20:33723580-33723602 GCCCCTAGGAACTACAGAAAAGG + Intergenic
1173080979 20:39867285-39867307 GGCCAAAGAAATCACAGAAGAGG + Intergenic
1173199939 20:40946955-40946977 GGCCCAAGTCACCACAGACAAGG + Intergenic
1173975124 20:47181017-47181039 GGAACATGACACCACAGAAATGG + Intronic
1174183521 20:48689722-48689744 GGCCCGATAAACCACTGAACTGG - Intronic
1175864222 20:62166063-62166085 GGGCACAGACACCACAGAAAGGG - Intronic
1176894760 21:14363429-14363451 GGCTAATGAAAGCACAGAAAAGG - Intergenic
1179451166 21:41469336-41469358 GTCTCAAGGAACCACAGCAATGG + Intronic
1181646442 22:24233762-24233784 GGCCCAAGAACACCCAGAAACGG + Intronic
1181781839 22:25199561-25199583 ACCCCAAGAAACCAAAGAAAGGG + Intergenic
1183566951 22:38622363-38622385 GGGCCAAGGAGCCCCAGAAATGG - Intronic
1184815827 22:46868975-46868997 GGGCAAAGAACCCCCAGAAAGGG - Intronic
951657231 3:25023126-25023148 AGGCCAAGTAGCCACAGAAAGGG - Intergenic
951845835 3:27083299-27083321 TCCCTAAGAACCCACAGAAATGG - Intergenic
952316304 3:32235660-32235682 ATCCAAAGAAACCACAGAAAAGG + Intergenic
953144236 3:40259221-40259243 GTTCAAAGAAACCACAGACATGG - Exonic
954255130 3:49399918-49399940 AACTCAAGAAACTACAGAAACGG + Intronic
954544604 3:51422269-51422291 AGACCAAGAAACAACAAAAATGG + Intronic
954944326 3:54405927-54405949 GGCCCACGGATACACAGAAAGGG + Intronic
955196479 3:56809099-56809121 GTGCCAAGAAACCCCAGAACAGG + Intronic
955482607 3:59404712-59404734 GGCTCAAGAAAACACTAAAAGGG - Intergenic
956603504 3:71048898-71048920 GGCCACAGAGACAACAGAAAAGG - Intronic
956698848 3:71941308-71941330 GTCCCAAAAAACAACAAAAACGG + Intergenic
958068978 3:88584659-88584681 AGCCCAAGAAAACACAGATGTGG + Intergenic
960173936 3:114495321-114495343 GGCCCAAGGTACAACGGAAATGG + Intronic
960449406 3:117788274-117788296 GGCCTAAGAAGCCACAGGAATGG + Intergenic
961103777 3:124223728-124223750 GACCCACAAAACCACAGACAGGG + Intronic
961140688 3:124553362-124553384 GACCCAGTAATCCACAGAAAGGG + Intronic
961359950 3:126360721-126360743 GGTCCAAGAAGACACAGAGAAGG + Intergenic
962382846 3:134911283-134911305 GGAGCAGGAAACCACAGAAAAGG + Intronic
963199803 3:142574732-142574754 GGCCCAAGAAAGAACACAAAGGG + Intronic
964529049 3:157647368-157647390 TGCCCAAGACAGCTCAGAAATGG + Intronic
965697888 3:171428367-171428389 GCCCCCAGAAACCAGAAAAATGG + Intronic
965794166 3:172421291-172421313 GACCTAAGAAACTAGAGAAAAGG - Intergenic
966710122 3:182963320-182963342 GGCCCACTAAAAAACAGAAAGGG + Intronic
966913966 3:184574894-184574916 GGCAGATGAAACCCCAGAAAAGG + Intronic
968728891 4:2260699-2260721 GGCTCAGGATGCCACAGAAATGG + Intronic
969524855 4:7699223-7699245 GGCGCAGGAAACCACAGGAATGG + Intronic
969605639 4:8201004-8201026 GCCCCCAGAAACCTCAGAATGGG - Intronic
969838641 4:9864134-9864156 AAGCCAAGAAACCAAAGAAAGGG - Intronic
972643605 4:40947320-40947342 GTCCTCATAAACCACAGAAATGG - Intronic
975978481 4:80127060-80127082 TGCCCAAGAATACACAGGAAAGG - Intergenic
976350934 4:84059192-84059214 AGCCCAAGAAACCACAAACTGGG - Intergenic
978605632 4:110476265-110476287 GGCGCAAGAAGCCAGAGAGAGGG + Exonic
978714899 4:111830153-111830175 GTCCAGAGAAAACACAGAAAGGG + Intergenic
979593116 4:122503277-122503299 GGCTCAAAATACCACAGAAGTGG - Intergenic
979606522 4:122644445-122644467 AGCCCAACCAACCACAGAACTGG + Intergenic
979972038 4:127147647-127147669 GGCCCAAGAAACATCAGGGAGGG - Intergenic
980093911 4:128470235-128470257 GGCCCAGGTAAGCACAGAATGGG - Intergenic
980758732 4:137200107-137200129 GGACCAAGAAATCAAACAAATGG - Intergenic
983988413 4:174089076-174089098 GAGCCAGGAAAGCACAGAAATGG - Intergenic
984790330 4:183609287-183609309 GGCCCCAGAAAAGGCAGAAAAGG - Intergenic
984813137 4:183813017-183813039 GGCCCCAGAACCCACAGACACGG - Intergenic
985161493 4:187048961-187048983 GACCCAAAGAACCACAGAGAGGG - Intergenic
986982543 5:13465911-13465933 TGCTCAGGAAACCTCAGAAAAGG + Intergenic
987585720 5:19853560-19853582 AGGGCAAGAAACCACTGAAAGGG + Intronic
988849665 5:35167224-35167246 GATCCAAGATCCCACAGAAAAGG + Intronic
989253571 5:39343036-39343058 GGCCTCTTAAACCACAGAAAAGG + Intronic
990090533 5:52041437-52041459 GTCCCAAGAATCTACAAAAAAGG + Intronic
991962475 5:72058991-72059013 AGCACAAGCAACCAAAGAAAAGG + Intergenic
994355312 5:98787835-98787857 GGCCCAGGAAGACACATAAAAGG - Intronic
998507397 5:142682975-142682997 AGCCCAAACAACCACAGAGAAGG - Intronic
999422849 5:151459714-151459736 TCCACAAGAAAACACAGAAAAGG - Intronic
1000140502 5:158398764-158398786 GGCTCAACAAACCACAGTAAGGG - Intergenic
1001478041 5:172064895-172064917 GGCCAGAGAAACCAAAGAAGAGG + Intronic
1002586101 5:180249370-180249392 GGCCTGCGAGACCACAGAAAGGG - Intronic
1002837963 6:881229-881251 TGCCTAAGAAAACACAGACAGGG + Intergenic
1005195687 6:23281127-23281149 GGACCAGGGAAGCACAGAAAGGG - Intergenic
1006098235 6:31669546-31669568 GGCCCAAGATCCCCCAGAGAGGG + Intronic
1006505024 6:34483571-34483593 GGCGCCAGAAACCACGTAAAGGG - Intronic
1007113401 6:39326765-39326787 GGCCACAAAAGCCACAGAAAGGG + Intergenic
1008884582 6:56418280-56418302 GGGCCAAGGAATCACAGAGAAGG + Intergenic
1008970601 6:57363229-57363251 GACCCAAGAAAACATAGAAATGG + Intronic
1011051166 6:83151563-83151585 GGCCAAAGAGAAAACAGAAACGG - Intronic
1012570479 6:100720317-100720339 GTGCAAAGAAAACACAGAAAAGG + Intronic
1013016804 6:106167384-106167406 GGACCAAGCCACCTCAGAAATGG + Intergenic
1015113034 6:129615525-129615547 GTCCCAAGAAATTTCAGAAACGG + Intronic
1016843891 6:148552049-148552071 TACCCAAGAAACAACAAAAAAGG - Exonic
1017159468 6:151351376-151351398 TGCTGAAGAGACCACAGAAATGG + Exonic
1017364138 6:153613415-153613437 AGCACAAGACACAACAGAAAGGG - Intergenic
1017838823 6:158204867-158204889 GACTCCAGGAACCACAGAAATGG + Intergenic
1020056200 7:5118913-5118935 GCCTCAAGAAGCCACAGATAAGG - Intergenic
1020729339 7:11862266-11862288 GGGCCCACTAACCACAGAAATGG + Intergenic
1021594466 7:22300578-22300600 GACCCAAGGTACCATAGAAAAGG - Intronic
1021847260 7:24775018-24775040 AGACAAAGAAACCACAGAGATGG - Intergenic
1025014182 7:55425569-55425591 GCCCAGAGAAACCACAGATAAGG - Intronic
1026166945 7:67918607-67918629 TGCCCATGAAAACCCAGAAATGG - Intergenic
1027463461 7:78484878-78484900 TGCCCAAGAACCCACAGATTAGG + Intronic
1027987653 7:85314748-85314770 AGCGCAGGAAACCACCGAAAAGG + Intergenic
1028848598 7:95511331-95511353 GCCGCAAGAAAACAAAGAAAAGG - Intronic
1029010351 7:97254201-97254223 AGCCAAAGAAAACATAGAAACGG + Intergenic
1030110128 7:106019863-106019885 GGCCCAAGAAAGCAGAGCCAGGG + Intronic
1030190390 7:106804840-106804862 GGCCTGAGCAACCACAAAAATGG + Intergenic
1030810639 7:113968443-113968465 CTCCCAAGAAACCACAGATGGGG - Intronic
1032108361 7:129054349-129054371 GGCCCAAGAAGCAACGGCAAAGG + Intronic
1033109932 7:138564717-138564739 AGCCAAAGGAACCACAGATAGGG - Intronic
1033537561 7:142326107-142326129 GACTCAGGAAGCCACAGAAATGG + Intergenic
1034033333 7:147791950-147791972 TGGCCCAGAAACCACACAAATGG + Intronic
1034590061 7:152131252-152131274 GTACCAAGAAAACACAGAACGGG + Intergenic
1035069438 7:156131018-156131040 GACCCAAGAAACAGCTGAAAAGG - Intergenic
1037100475 8:15037878-15037900 GGCTCAAGAAACCAGAAATAAGG + Intronic
1037625225 8:20600659-20600681 GACCCAGGAAGCCACAGGAAAGG + Intergenic
1038277457 8:26133836-26133858 TGCCCAAGAAACCAGGGAACAGG - Intergenic
1039369688 8:36972230-36972252 GGTCCAAGAAACCAGAGAATAGG - Intergenic
1041903128 8:63004029-63004051 GTGCCCAGAAACCACACAAAGGG - Intergenic
1042228998 8:66538263-66538285 GGCCCATGGAACCAAAGCAAAGG + Intergenic
1043161240 8:76850667-76850689 GCCTCAAGAAATTACAGAAAAGG - Intronic
1043749295 8:83915485-83915507 GGTCAAAGAAACCCCAGGAAAGG + Intergenic
1044940525 8:97337497-97337519 GTCCTAAGATACTACAGAAAAGG + Intergenic
1046181535 8:110655578-110655600 GGACAAAGAAAACACAGATATGG + Intergenic
1046498849 8:115048821-115048843 GGCCCATGAAACCTCAGGACAGG + Intergenic
1047109061 8:121768316-121768338 GGGCCAAGAAATTGCAGAAATGG - Intergenic
1047838774 8:128724154-128724176 GGGCCAAGAAGCCAAACAAAAGG + Intergenic
1048221774 8:132548847-132548869 AGAGCAAGAAACCCCAGAAAAGG - Intergenic
1048305305 8:133279828-133279850 GGGCCAGTAAACCACAGAGAAGG + Intronic
1048880009 8:138864259-138864281 GGCCCAGGAGACCCCAGGAATGG - Intronic
1049385127 8:142339351-142339373 GGCCCAGGCGACCACAGAGATGG + Intronic
1049684400 8:143933585-143933607 GGCCCAGGACCCCACAGACATGG - Intronic
1049889169 9:52255-52277 GGACCAAGAGACCACCCAAATGG + Intergenic
1051876037 9:21794304-21794326 GGCCCAAGATCCCAGAGGAATGG - Intergenic
1052223194 9:26052769-26052791 GGCCCAGGAGAACACAGGAAGGG - Intergenic
1052330649 9:27264438-27264460 GGAGCAAGAAGCTACAGAAAAGG - Intergenic
1052691605 9:31822041-31822063 GGCCCAAGTAACCATGGAAAGGG + Intergenic
1052790281 9:32869316-32869338 AGCCCCACAAACCACAGCAATGG + Intergenic
1053730654 9:41053540-41053562 GGACCAAGAGACCACCCAAATGG + Intergenic
1054697844 9:68378536-68378558 GGACCAAGAGACCACCCAAATGG - Intronic
1054701509 9:68417861-68417883 AGCCCAAGAAACCAGAGACAGGG - Intronic
1054765514 9:69039456-69039478 GAACCAAGAATCCACAGAAACGG + Intronic
1056502874 9:87227641-87227663 GGAACAGGAAACCACAGATAAGG - Intergenic
1056796662 9:89663320-89663342 GGCCCAAGAATCCCCAGAACTGG + Intergenic
1056985446 9:91360592-91360614 TGCCCAAGAACCCTCACAAATGG + Intronic
1057820970 9:98330399-98330421 GGACAAAAAAATCACAGAAATGG + Intronic
1058532473 9:105920357-105920379 GACACAAGAGACCACTGAAAGGG - Intergenic
1060082464 9:120663162-120663184 GCCCCAAAAAACCAAAGGAAAGG + Intronic
1060992269 9:127856010-127856032 GGCCCATGAAAGCTCAGAGAAGG + Intergenic
1061675155 9:132211386-132211408 GGGACAAAAAACTACAGAAAGGG - Intronic
1062196514 9:135277061-135277083 GGCCAAAGAAACACCAGCAAGGG + Intergenic
1062372559 9:136247543-136247565 GGCCAAAGCAACCAGAGGAATGG + Intergenic
1185541375 X:905518-905540 GCCCCAAAAAACCACAGATTGGG + Intergenic
1187445893 X:19360754-19360776 GGCCTCAGAAACCAAAGACAAGG - Exonic
1188965288 X:36544258-36544280 GACCCAAGAGACAAAAGAAAAGG - Intergenic
1189234950 X:39479569-39479591 GGCCCAGGAAGCCACACATAGGG - Intergenic
1193678553 X:84487510-84487532 GACCCAAAATAACACAGAAAAGG - Intronic
1194095512 X:89634005-89634027 GGTTCAAAAGACCACAGAAATGG - Intergenic
1194947511 X:100086845-100086867 GGACCAAGATCCCAGAGAAAAGG + Intergenic
1195223775 X:102771368-102771390 TGCCCAAGGAACCCCAGAGAGGG - Intergenic
1196458063 X:115903685-115903707 TCCCCAAGCAACCACAGGAAGGG + Intergenic
1200146914 X:153931087-153931109 CTCACAAGAAACCGCAGAAATGG - Intronic
1200312634 X:155094501-155094523 GGTCCAAGAAATCACATAAAGGG + Intronic
1200448145 Y:3290184-3290206 GGTTCAAAAGACCACAGAAATGG - Intergenic