ID: 929042405

View in Genome Browser
Species Human (GRCh38)
Location 2:37758333-37758355
Sequence CAGGAAAAAGTCTAACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929042405_929042411 5 Left 929042405 2:37758333-37758355 CCATGGGGTTAGACTTTTTCCTG No data
Right 929042411 2:37758361-37758383 TGGATTTATGGCCTCACATGTGG No data
929042405_929042407 -7 Left 929042405 2:37758333-37758355 CCATGGGGTTAGACTTTTTCCTG No data
Right 929042407 2:37758349-37758371 TTTCCTGCCCTGTGGATTTATGG No data
929042405_929042415 27 Left 929042405 2:37758333-37758355 CCATGGGGTTAGACTTTTTCCTG No data
Right 929042415 2:37758383-37758405 GATGGGAGAAATGCAACAGCAGG No data
929042405_929042412 9 Left 929042405 2:37758333-37758355 CCATGGGGTTAGACTTTTTCCTG No data
Right 929042412 2:37758365-37758387 TTTATGGCCTCACATGTGGATGG No data
929042405_929042413 10 Left 929042405 2:37758333-37758355 CCATGGGGTTAGACTTTTTCCTG No data
Right 929042413 2:37758366-37758388 TTATGGCCTCACATGTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929042405 Original CRISPR CAGGAAAAAGTCTAACCCCA TGG (reversed) Intergenic