ID: 929043437

View in Genome Browser
Species Human (GRCh38)
Location 2:37768859-37768881
Sequence ATGCCTGTCTATATGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929043435_929043437 22 Left 929043435 2:37768814-37768836 CCGAGTTTATTGTGTTGTGTGGC No data
Right 929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG No data
929043432_929043437 24 Left 929043432 2:37768812-37768834 CCCCGAGTTTATTGTGTTGTGTG No data
Right 929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG No data
929043433_929043437 23 Left 929043433 2:37768813-37768835 CCCGAGTTTATTGTGTTGTGTGG No data
Right 929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929043437 Original CRISPR ATGCCTGTCTATATGCAGGA TGG Intergenic
No off target data available for this crispr