ID: 929044239

View in Genome Browser
Species Human (GRCh38)
Location 2:37775008-37775030
Sequence TGCTCCTCACACATGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929044239_929044245 7 Left 929044239 2:37775008-37775030 CCAGAGACCATGTGTGAGGAGCA No data
Right 929044245 2:37775038-37775060 TACAGATGGGCTTTCTGCTCTGG No data
929044239_929044244 -6 Left 929044239 2:37775008-37775030 CCAGAGACCATGTGTGAGGAGCA No data
Right 929044244 2:37775025-37775047 GGAGCAAAGTGGGTACAGATGGG No data
929044239_929044246 23 Left 929044239 2:37775008-37775030 CCAGAGACCATGTGTGAGGAGCA No data
Right 929044246 2:37775054-37775076 GCTCTGGAGCCTTCTGATCATGG No data
929044239_929044243 -7 Left 929044239 2:37775008-37775030 CCAGAGACCATGTGTGAGGAGCA No data
Right 929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929044239 Original CRISPR TGCTCCTCACACATGGTCTC TGG (reversed) Intergenic
No off target data available for this crispr