ID: 929044243

View in Genome Browser
Species Human (GRCh38)
Location 2:37775024-37775046
Sequence AGGAGCAAAGTGGGTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929044239_929044243 -7 Left 929044239 2:37775008-37775030 CCAGAGACCATGTGTGAGGAGCA No data
Right 929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929044243 Original CRISPR AGGAGCAAAGTGGGTACAGA TGG Intergenic
No off target data available for this crispr