ID: 929045867

View in Genome Browser
Species Human (GRCh38)
Location 2:37788637-37788659
Sequence GTGAGCAATAGAAATACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929045866_929045867 6 Left 929045866 2:37788608-37788630 CCATCAGACATATGAGGAAAGCT No data
Right 929045867 2:37788637-37788659 GTGAGCAATAGAAATACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929045867 Original CRISPR GTGAGCAATAGAAATACTAC TGG Intergenic
No off target data available for this crispr