ID: 929047396

View in Genome Browser
Species Human (GRCh38)
Location 2:37803387-37803409
Sequence TTAGCCACATAACACCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929047396_929047400 15 Left 929047396 2:37803387-37803409 CCAAAATGGTGTTATGTGGCTAA No data
Right 929047400 2:37803425-37803447 CTGGAAAATACAAATATTCCAGG No data
929047396_929047397 -4 Left 929047396 2:37803387-37803409 CCAAAATGGTGTTATGTGGCTAA No data
Right 929047397 2:37803406-37803428 CTAATGAATGCCCACTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929047396 Original CRISPR TTAGCCACATAACACCATTT TGG (reversed) Intergenic
No off target data available for this crispr