ID: 929049490

View in Genome Browser
Species Human (GRCh38)
Location 2:37823923-37823945
Sequence GTGACGAAGTGGAAGTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929049483_929049490 16 Left 929049483 2:37823884-37823906 CCTTTTTTCCAGGAACTCTGTCC No data
Right 929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG No data
929049484_929049490 8 Left 929049484 2:37823892-37823914 CCAGGAACTCTGTCCTCTGTGCC No data
Right 929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG No data
929049482_929049490 20 Left 929049482 2:37823880-37823902 CCTTCCTTTTTTCCAGGAACTCT No data
Right 929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG No data
929049487_929049490 -5 Left 929049487 2:37823905-37823927 CCTCTGTGCCTGGAGGCTGTGAC No data
Right 929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929049490 Original CRISPR GTGACGAAGTGGAAGTTGCA AGG Intergenic
No off target data available for this crispr