ID: 929050208

View in Genome Browser
Species Human (GRCh38)
Location 2:37829992-37830014
Sequence CAGTTTTCTCAGTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929050208_929050214 -1 Left 929050208 2:37829992-37830014 CCCTCCTCAAACTGAGAAAACTG No data
Right 929050214 2:37830014-37830036 GAGGACTCTGTGGGTGAGCCTGG No data
929050208_929050213 -10 Left 929050208 2:37829992-37830014 CCCTCCTCAAACTGAGAAAACTG No data
Right 929050213 2:37830005-37830027 GAGAAAACTGAGGACTCTGTGGG No data
929050208_929050215 5 Left 929050208 2:37829992-37830014 CCCTCCTCAAACTGAGAAAACTG No data
Right 929050215 2:37830020-37830042 TCTGTGGGTGAGCCTGGACATGG No data
929050208_929050216 9 Left 929050208 2:37829992-37830014 CCCTCCTCAAACTGAGAAAACTG No data
Right 929050216 2:37830024-37830046 TGGGTGAGCCTGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929050208 Original CRISPR CAGTTTTCTCAGTTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr