ID: 929050538

View in Genome Browser
Species Human (GRCh38)
Location 2:37832908-37832930
Sequence GTAGCTGCTTTGTTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929050538_929050542 2 Left 929050538 2:37832908-37832930 CCTTCCCCAAACAAAGCAGCTAC No data
Right 929050542 2:37832933-37832955 CTCTACCAACACTTCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929050538 Original CRISPR GTAGCTGCTTTGTTTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr