ID: 929050582

View in Genome Browser
Species Human (GRCh38)
Location 2:37833441-37833463
Sequence TAAAATGGCCACTGTGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929050579_929050582 8 Left 929050579 2:37833410-37833432 CCAAAGCAAAGGGACAGCATTTA No data
Right 929050582 2:37833441-37833463 TAAAATGGCCACTGTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929050582 Original CRISPR TAAAATGGCCACTGTGGAAA TGG Intergenic
No off target data available for this crispr