ID: 929052689

View in Genome Browser
Species Human (GRCh38)
Location 2:37851385-37851407
Sequence CCTGGCACCGAGAAGTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929052683_929052689 -6 Left 929052683 2:37851368-37851390 CCCTTAAATGTTAGTTCCCTGGC No data
Right 929052689 2:37851385-37851407 CCTGGCACCGAGAAGTAGGTGGG No data
929052681_929052689 5 Left 929052681 2:37851357-37851379 CCTGCACAAAACCCTTAAATGTT No data
Right 929052689 2:37851385-37851407 CCTGGCACCGAGAAGTAGGTGGG No data
929052684_929052689 -7 Left 929052684 2:37851369-37851391 CCTTAAATGTTAGTTCCCTGGCA No data
Right 929052689 2:37851385-37851407 CCTGGCACCGAGAAGTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929052689 Original CRISPR CCTGGCACCGAGAAGTAGGT GGG Intergenic
No off target data available for this crispr