ID: 929052813

View in Genome Browser
Species Human (GRCh38)
Location 2:37852570-37852592
Sequence CTGTCACAGAAGTGGCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929052813_929052821 27 Left 929052813 2:37852570-37852592 CCATAAAGCCACTTCTGTGACAG No data
Right 929052821 2:37852620-37852642 CCTTGTGGAATCTAGAGAAAGGG No data
929052813_929052817 12 Left 929052813 2:37852570-37852592 CCATAAAGCCACTTCTGTGACAG No data
Right 929052817 2:37852605-37852627 AGTGACATGTGGAACCCTTGTGG No data
929052813_929052819 26 Left 929052813 2:37852570-37852592 CCATAAAGCCACTTCTGTGACAG No data
Right 929052819 2:37852619-37852641 CCCTTGTGGAATCTAGAGAAAGG No data
929052813_929052816 1 Left 929052813 2:37852570-37852592 CCATAAAGCCACTTCTGTGACAG No data
Right 929052816 2:37852594-37852616 GAAGTGAAGGCAGTGACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929052813 Original CRISPR CTGTCACAGAAGTGGCTTTA TGG (reversed) Intergenic
No off target data available for this crispr