ID: 929055649

View in Genome Browser
Species Human (GRCh38)
Location 2:37874113-37874135
Sequence GTCCCAGATACTAACACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929055649_929055655 12 Left 929055649 2:37874113-37874135 CCAGCAGTGTTAGTATCTGGGAC No data
Right 929055655 2:37874148-37874170 GACATAACCAGTGGCAGCTGGGG No data
929055649_929055652 3 Left 929055649 2:37874113-37874135 CCAGCAGTGTTAGTATCTGGGAC No data
Right 929055652 2:37874139-37874161 AGCATTGGTGACATAACCAGTGG No data
929055649_929055653 10 Left 929055649 2:37874113-37874135 CCAGCAGTGTTAGTATCTGGGAC No data
Right 929055653 2:37874146-37874168 GTGACATAACCAGTGGCAGCTGG No data
929055649_929055654 11 Left 929055649 2:37874113-37874135 CCAGCAGTGTTAGTATCTGGGAC No data
Right 929055654 2:37874147-37874169 TGACATAACCAGTGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929055649 Original CRISPR GTCCCAGATACTAACACTGC TGG (reversed) Intergenic
No off target data available for this crispr