ID: 929055654

View in Genome Browser
Species Human (GRCh38)
Location 2:37874147-37874169
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929055649_929055654 11 Left 929055649 2:37874113-37874135 CCAGCAGTGTTAGTATCTGGGAC No data
Right 929055654 2:37874147-37874169 TGACATAACCAGTGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr