ID: 929057912

View in Genome Browser
Species Human (GRCh38)
Location 2:37894454-37894476
Sequence CTGTCTTGATGGAGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929057912_929057920 17 Left 929057912 2:37894454-37894476 CCAGCTTTCCTCCATCAAGACAG No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929057912 Original CRISPR CTGTCTTGATGGAGGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr