ID: 929057920

View in Genome Browser
Species Human (GRCh38)
Location 2:37894494-37894516
Sequence CCTCAATGCCACCCCCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929057915_929057920 6 Left 929057915 2:37894465-37894487 CCATCAAGACAGCCCAAGGAGAA No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data
929057912_929057920 17 Left 929057912 2:37894454-37894476 CCAGCTTTCCTCCATCAAGACAG No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data
929057917_929057920 -7 Left 929057917 2:37894478-37894500 CCAAGGAGAAAACAACCCTCAAT No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data
929057916_929057920 -6 Left 929057916 2:37894477-37894499 CCCAAGGAGAAAACAACCCTCAA No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data
929057910_929057920 26 Left 929057910 2:37894445-37894467 CCTTTCCAACCAGCTTTCCTCCA No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data
929057914_929057920 9 Left 929057914 2:37894462-37894484 CCTCCATCAAGACAGCCCAAGGA No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data
929057911_929057920 21 Left 929057911 2:37894450-37894472 CCAACCAGCTTTCCTCCATCAAG No data
Right 929057920 2:37894494-37894516 CCTCAATGCCACCCCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929057920 Original CRISPR CCTCAATGCCACCCCCATAC TGG Intergenic
No off target data available for this crispr