ID: 929064151

View in Genome Browser
Species Human (GRCh38)
Location 2:37956177-37956199
Sequence GTGAAAGCCCAAATATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929064151 Original CRISPR GTGAAAGCCCAAATATTTGG TGG (reversed) Intronic
903460741 1:23518993-23519015 GTGAGAGGGGAAATATTTGGTGG - Intronic
905135579 1:35796637-35796659 GTGAAATCTCAAATAATTTGTGG + Intergenic
906594087 1:47058193-47058215 GTAGAAGCCAAAATATTTAGAGG - Intergenic
906804556 1:48767826-48767848 GATAATGCCCAAATCTTTGGTGG - Intronic
909667980 1:78157502-78157524 GACAAAGCCCAAATATTTGAAGG + Intergenic
914248515 1:145903152-145903174 GTGAGAGCTCAAATGTTTGAAGG + Intronic
914837599 1:151220587-151220609 CTGTAATCCCAAATACTTGGAGG - Intronic
916101503 1:161397063-161397085 AAAAAAGCCCAAATATTTGAAGG - Intergenic
917428691 1:174942844-174942866 GTATAAGCACCAATATTTGGGGG - Intronic
918056323 1:181024703-181024725 GTGAAAGCCAAAATCCCTGGAGG + Intergenic
918166032 1:181948696-181948718 GTGCAAGCCCCAAGTTTTGGTGG + Intergenic
918534008 1:185554152-185554174 GTGAAACCCCACAGATGTGGTGG - Intergenic
918833589 1:189430750-189430772 AAGAAAGGCAAAATATTTGGTGG + Intergenic
922653653 1:227362472-227362494 GTGAGAGCCGTAAGATTTGGGGG + Intergenic
1065459049 10:25936275-25936297 GTCAAATCCAAAATATTTGAAGG + Intronic
1068155129 10:53188137-53188159 GTGCAAGCCCAAAGCCTTGGTGG + Intergenic
1068698229 10:59992194-59992216 TTGAAAGTACAAATATTTGGTGG + Intergenic
1068911160 10:62379788-62379810 CTGAAAGGCCAACTCTTTGGTGG - Intronic
1069030388 10:63589715-63589737 GTCAAAATCCCAATATTTGGAGG - Intronic
1069950260 10:72013798-72013820 GAGAAAACCCAGGTATTTGGGGG + Intergenic
1070468596 10:76752590-76752612 GTAAATGCCCAAATATTTGGAGG + Intergenic
1070917436 10:80163902-80163924 GTCAAAGCCCAAAGTATTGGGGG + Intronic
1073863254 10:107771104-107771126 GTGAATGCACAAACATATGGTGG + Intergenic
1074112785 10:110434146-110434168 GGGAAAGCCCAAGTGTTTGAAGG - Intergenic
1074355101 10:112775817-112775839 TTTAAAACCCACATATTTGGAGG - Intronic
1077857291 11:6141432-6141454 GTGACAGTCTAAAAATTTGGGGG - Intergenic
1077971696 11:7199294-7199316 GTAAAAGACCACATATTTGGAGG - Intergenic
1079162129 11:18005021-18005043 GGGAAAGCCTAGAGATTTGGGGG + Intronic
1079491116 11:20990160-20990182 ATGAAAGGGCAAATATTTGCAGG - Intronic
1079721247 11:23817058-23817080 GTGAAAGCCCTAAGGCTTGGTGG - Intergenic
1084160162 11:67344043-67344065 CTGTAATCCCAAATATTTGGGGG - Intronic
1086029086 11:82331881-82331903 GTGAAAGACCAAATGTTTGGAGG + Intergenic
1087251938 11:95911432-95911454 GTGAAAGCCAAAGTATTCTGCGG + Intronic
1087574825 11:99976585-99976607 GTGAAAGCCCCAAGCCTTGGTGG - Intronic
1088182508 11:107128337-107128359 GTGAAAGCACAAAGATATGGTGG - Intergenic
1088356985 11:108954537-108954559 GTTAAGGCCCAGATATTTGTGGG + Intergenic
1088860791 11:113797430-113797452 GTGAAAACCCAAGTGTATGGAGG + Intergenic
1090742046 11:129672639-129672661 GTCAAATCCCAAATATTTAAGGG - Intergenic
1090878070 11:130808924-130808946 GTGAATGCCCAAGTCTCTGGAGG - Intergenic
1090909190 11:131103831-131103853 ATGAAAACCCAAATATATGAGGG + Intergenic
1093768043 12:22987417-22987439 GTTAAAGCAGAAATCTTTGGGGG - Intergenic
1095345887 12:41148287-41148309 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
1096860707 12:54525858-54525880 GTGAAATCTCAGATACTTGGGGG + Intronic
1097709923 12:62907061-62907083 GTATAAACCCAAAGATTTGGAGG - Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1100345055 12:93721482-93721504 GGCAAAGCCCACATATATGGAGG - Intronic
1100597915 12:96087616-96087638 GTGCAAGCCCCAAGCTTTGGTGG + Intergenic
1100783327 12:98052645-98052667 GTGTAAGCCCAGATATGTGTGGG - Intergenic
1103585752 12:121954244-121954266 GGGAAAGCCCAAAAAGGTGGAGG - Exonic
1105419288 13:20238521-20238543 GTTAGAGCCCAACTATCTGGGGG - Intergenic
1105637917 13:22233681-22233703 TTGGCAGGCCAAATATTTGGGGG - Intergenic
1108085010 13:46778589-46778611 GTAAAAGACCAACTAATTGGAGG - Intronic
1108381308 13:49857238-49857260 GGGAAAGCCCAACAATTTGGGGG - Intergenic
1108681274 13:52782651-52782673 CTGAGAGCCAAAGTATTTGGGGG + Intergenic
1109108638 13:58288232-58288254 GGTAAAACCCAACTATTTGGGGG - Intergenic
1109349413 13:61158515-61158537 GTGAAGACTGAAATATTTGGTGG - Intergenic
1109889527 13:68590540-68590562 TTGAAAGACAAAATATTTAGGGG + Intergenic
1109896162 13:68694038-68694060 CTGTAACCCCAACTATTTGGGGG - Intergenic
1109906238 13:68845956-68845978 GTGAAAGCCCCAAGACTTAGTGG + Intergenic
1110151441 13:72259615-72259637 GTGTAAGACCAGATACTTGGAGG + Intergenic
1110929231 13:81194455-81194477 GTGCAAGCCCAAAGCCTTGGAGG - Intergenic
1111065737 13:83089197-83089219 GTGCAAGCCCAAAGCCTTGGTGG + Intergenic
1112471484 13:99693640-99693662 GTGGAAACCCCAGTATTTGGGGG + Intronic
1112668885 13:101612276-101612298 GTGAAACAGCAAATATTTTGAGG + Intronic
1114251695 14:20967417-20967439 GAGAAAGACCAAGTACTTGGAGG + Intergenic
1114839234 14:26244101-26244123 TTGAAAGCTTAAAAATTTGGAGG + Intergenic
1115371931 14:32626031-32626053 GTGGAAGCACTAACATTTGGTGG + Intronic
1115599374 14:34940768-34940790 CTGTAATCCCAACTATTTGGGGG + Intergenic
1116050146 14:39792543-39792565 GTGAATACTGAAATATTTGGAGG - Intergenic
1116278276 14:42866029-42866051 TTGAAAGGCCAAATAATTTGAGG - Intergenic
1117990127 14:61424954-61424976 GTGCAAGCCCCAATCCTTGGTGG + Intronic
1118526005 14:66644013-66644035 GTGATAGCTTAATTATTTGGGGG + Intronic
1118912562 14:70073892-70073914 GAGAAAGCCCATATTTCTGGTGG + Intronic
1118977383 14:70689352-70689374 GTCACTGCCCAAATATTTTGTGG - Intergenic
1120525466 14:85571942-85571964 ATGCAACCCCAAATATTTTGGGG + Intronic
1120654168 14:87169394-87169416 GTGAAAGCCCCAAGCATTGGTGG - Intergenic
1122765521 14:104066785-104066807 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
1128956492 15:71952039-71952061 GTGAATGTCCAATTATTTTGAGG + Intronic
1129197154 15:73975481-73975503 ATGAAAGGCCAAATATTTTAAGG - Intergenic
1132401997 15:101516316-101516338 CTTAAATTCCAAATATTTGGGGG + Intronic
1132969900 16:2682108-2682130 CCTAAAGCACAAATATTTGGGGG - Intergenic
1134285484 16:12858193-12858215 TTGTAAGCAAAAATATTTGGAGG - Intergenic
1134321125 16:13164776-13164798 GAAAATGCCCAAATATTTGGTGG - Intronic
1135848042 16:25936951-25936973 GCCAAATGCCAAATATTTGGTGG - Intronic
1138380768 16:56600794-56600816 GTGAAACCCAAAATCTCTGGGGG + Intergenic
1138399723 16:56735664-56735686 GTGAAACCCCAAAAATTAGCTGG + Intronic
1145358137 17:22182463-22182485 GTGCAAGCCCAAAGCCTTGGTGG + Intergenic
1145364998 17:22253955-22253977 CTGAAAAACCAAATATTTTGTGG - Intergenic
1153447137 18:5186893-5186915 GAGAATTCCCAAATAATTGGAGG + Intronic
1155635614 18:27951814-27951836 GTAAAAGACAAAATATTTTGTGG - Exonic
1155745806 18:29355602-29355624 GTACAAGCCCCAAGATTTGGAGG + Intergenic
1156051669 18:32943643-32943665 GAGAAAGAGCAAATATTTTGTGG + Intronic
1158124058 18:54082726-54082748 GTGTAAGCCCCAAGCTTTGGTGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160452661 18:78976208-78976230 ATGAAAGCCCTAATATTTGAAGG + Intergenic
1161655841 19:5514400-5514422 GAGAACTCCTAAATATTTGGTGG - Intergenic
1163328166 19:16618618-16618640 GCCAAGGCCCAACTATTTGGCGG + Intronic
1165257265 19:34585893-34585915 GTGAAATCCAGAATAATTGGTGG + Intergenic
1166819819 19:45570961-45570983 GTGACAGCAAAACTATTTGGGGG + Intronic
925453359 2:3990743-3990765 GTGGAAGCCCCAAGACTTGGAGG - Intergenic
925494861 2:4435520-4435542 GTGCAAGCCCCAAGCTTTGGAGG - Intergenic
926281718 2:11454045-11454067 GTGAAAGTCCACATGTTCGGTGG - Intronic
928555632 2:32421621-32421643 GAGAAACCTCAAGTATTTGGAGG - Intronic
929064151 2:37956177-37956199 GTGAAAGCCCAAATATTTGGTGG - Intronic
930010040 2:46930044-46930066 GTGAAAGCCCTGAGATTTTGGGG + Intronic
931628631 2:64279731-64279753 GTCATAGCCAAAATATTTGGGGG + Intergenic
931628957 2:64282589-64282611 GTCATAGCCAAAATATTTGGGGG + Intergenic
933209748 2:79552701-79552723 GTGCAAGCCAAAAGCTTTGGTGG - Intronic
937462038 2:122097826-122097848 GTGAAAATCCAAATATTTTAAGG + Intergenic
938724447 2:134094925-134094947 GTTAAATCACAAAAATTTGGGGG - Intergenic
939754630 2:146094294-146094316 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
940402887 2:153267485-153267507 GTGCAAGCCCCAATCCTTGGTGG - Intergenic
940485268 2:154289146-154289168 GTGCAAGCCCCAAACTTTGGTGG - Intronic
941579965 2:167283823-167283845 GTGAAAGTCCAAAAAATTGGAGG + Intergenic
942991447 2:182207913-182207935 GTGAAAGCCCCAAGCCTTGGTGG + Intronic
943177087 2:184490475-184490497 TTTAAAACCAAAATATTTGGTGG + Intergenic
945832243 2:214801829-214801851 GTTGAAAACCAAATATTTGGCGG + Intronic
946543999 2:220716386-220716408 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
946874491 2:224114256-224114278 GTGCAAGCCCCAAGACTTGGTGG + Intergenic
948956836 2:241299616-241299638 GTCAAAACCCAAATTTTGGGCGG + Intronic
1169460727 20:5792540-5792562 GTGTAATCCCAGCTATTTGGGGG - Intronic
1169532826 20:6503902-6503924 GTGAATCCCCAAATATACGGAGG + Intergenic
1172893193 20:38281599-38281621 CTGAAAGCCCCAAGCTTTGGTGG - Intronic
1177532111 21:22373923-22373945 GTGCAAGCCCCAAGATTTGGTGG - Intergenic
1178603635 21:34016333-34016355 GTGAAATTCCAGATACTTGGGGG + Intergenic
1179124733 21:38580842-38580864 GAGAAGGCCTAAATATTTGCAGG + Intronic
1179167587 21:38946828-38946850 GTGGAAGCCCATATATCTTGGGG + Intergenic
1179644215 21:42765833-42765855 CTGAAAGCCCACCTATGTGGGGG + Intronic
1180884285 22:19229334-19229356 GTAAAAGGACAAATATTTTGTGG + Intronic
1181816498 22:25441164-25441186 TTTAATGTCCAAATATTTGGAGG - Intergenic
1182024329 22:27105910-27105932 GTGAAAGCCCCAGTTTTGGGAGG - Intergenic
1182945298 22:34316247-34316269 GTGCAAGCCCCAAGCTTTGGTGG + Intergenic
950307573 3:11928289-11928311 GTGAATGCACACATATTTTGAGG - Intergenic
950589303 3:13924792-13924814 GTGCAAGCCCCAAGCTTTGGTGG + Intergenic
951314433 3:21171299-21171321 GTGGGACCCCAAATCTTTGGTGG - Intergenic
951325323 3:21295641-21295663 CTGTAATCCCAACTATTTGGGGG - Intergenic
952220040 3:31315806-31315828 GTGCAAGCCCAAAGCCTTGGTGG + Intergenic
952247293 3:31607931-31607953 GTGTAATCCCAAATATTTTGTGG - Intronic
953569425 3:44059277-44059299 GTGAATGCCTAGAGATTTGGTGG + Intergenic
957267222 3:77982889-77982911 GTGCAAGCCCCAAGACTTGGTGG - Intergenic
957885980 3:86288174-86288196 AAGGAAGCCTAAATATTTGGTGG - Intergenic
957956569 3:87195986-87196008 GTGTAAGCCCAAAGCCTTGGTGG + Intergenic
958836862 3:99156638-99156660 GTGCAAGCCCTAAACTTTGGTGG + Intergenic
959284583 3:104391322-104391344 GTGAAAGCCCCAAGCCTTGGTGG - Intergenic
962031856 3:131609301-131609323 TGGAAAGCACAAATATTTGGTGG - Intronic
964610413 3:158609022-158609044 CTGAAATACCAAATATTTGGAGG - Intergenic
964853358 3:161119019-161119041 GTGCAAGCCCCAAGCTTTGGTGG + Intronic
965031836 3:163380255-163380277 GTGAAAGACGAAAGATTTGGAGG + Intergenic
965052005 3:163663185-163663207 GTGCAAGCCCCAAGGTTTGGTGG + Intergenic
965300437 3:167000071-167000093 CTGAAAGCACAGAGATTTGGGGG - Intergenic
965647294 3:170897545-170897567 GTGTAAGCCCTAATCCTTGGTGG + Intronic
965746939 3:171935851-171935873 GGCAAAGCCCAAATATGTGCTGG + Intronic
966011505 3:175084201-175084223 GTCAAAGCCACAAAATTTGGGGG - Intronic
967353629 3:188543413-188543435 GTGAAAGACCAAGAAGTTGGTGG - Intronic
970863317 4:20729915-20729937 CTGAAAGCTCAAATCTTTTGGGG + Exonic
971593372 4:28497325-28497347 GTGCAAGCCCCAATTTTTGGTGG + Intergenic
972711229 4:41597049-41597071 GTGAAAACCCAGATCTATGGTGG - Intronic
973142963 4:46792003-46792025 GTGATAGCTGAAATATTTAGAGG - Intronic
973752635 4:54037763-54037785 GTAAATCTCCAAATATTTGGAGG + Intronic
974139278 4:57863867-57863889 CAGAAAGCTAAAATATTTGGAGG + Intergenic
974153257 4:58037827-58037849 GGAAAAGCTCCAATATTTGGTGG + Intergenic
974903154 4:68025703-68025725 GTCACAGCCCAGATACTTGGTGG - Intergenic
975301723 4:72798012-72798034 GTGTAAGCCCAAAGCCTTGGTGG - Intergenic
975615394 4:76241434-76241456 ATCAGAGCCCTAATATTTGGAGG + Intronic
977471363 4:97447612-97447634 GTGCAAGCTCCAAGATTTGGTGG + Intronic
978666030 4:111183038-111183060 GTGCAAGCCCAAAGCCTTGGTGG - Intergenic
978904043 4:113985430-113985452 GTGCAAGCCCCAAGCTTTGGTGG + Intergenic
979125626 4:116968848-116968870 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
980272815 4:130608777-130608799 GTGAAAACACTGATATTTGGGGG - Intergenic
981320933 4:143390527-143390549 GTGAAAAAACAAAGATTTGGAGG - Intronic
981801834 4:148666714-148666736 GAAAATCCCCAAATATTTGGCGG - Intergenic
983700780 4:170591010-170591032 GTGACAGCCCAAATAAAAGGAGG - Intergenic
984685063 4:182658018-182658040 GTGAAAGCCCAACTGTAAGGGGG - Intronic
984693347 4:182754048-182754070 TAGAAAGCCCCAACATTTGGTGG + Intronic
985165680 4:187091373-187091395 TAGAAAACCCAAATATTTGGAGG - Intergenic
985346980 4:189016486-189016508 GTGGAAGACCAAATATTTTCAGG - Intergenic
985485113 5:144470-144492 GTTAAAGCCCAAATAAATGAGGG + Intronic
985980948 5:3462657-3462679 GTGAATGCCTGGATATTTGGAGG - Intergenic
986636289 5:9825034-9825056 GTGAAAGCCTGCATCTTTGGTGG - Intergenic
986810915 5:11359298-11359320 ATAAATGCCCAAATATTAGGGGG + Intronic
986840969 5:11697273-11697295 GTTAAGGTCCAAATTTTTGGGGG - Intronic
988074792 5:26338762-26338784 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
988099261 5:26656955-26656977 GTGAATGCCCCAAGATTTGGTGG - Intergenic
988204387 5:28115445-28115467 GTGGAAGCCCCAAGTTTTGGCGG - Intergenic
988897869 5:35697623-35697645 GTCAAATTCCAAACATTTGGAGG - Intronic
991222919 5:64236831-64236853 GTGAAAGCCCCAAGCCTTGGCGG + Intronic
993089333 5:83404908-83404930 GTGAAAGCATAAATATTTCCTGG - Intergenic
994368814 5:98946471-98946493 TTGACAGCCAAAATGTTTGGGGG + Intergenic
994552491 5:101255435-101255457 GTGAAAGCCCCAATTTATAGTGG + Intergenic
995595139 5:113739555-113739577 GTGAAAGCCACATTATTTTGTGG + Intergenic
995667199 5:114555290-114555312 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
995690966 5:114825378-114825400 GTGCAAGCCCAAAGCCTTGGTGG - Intergenic
995909021 5:117163495-117163517 TTGAAAGCCCAAACTTGTGGAGG - Intergenic
996899090 5:128523013-128523035 GTAAAAGCTCAGATATTTAGAGG + Intronic
997046945 5:130330230-130330252 GTGCAAGCCCCAATTCTTGGTGG + Intergenic
997103025 5:130989392-130989414 CTGAAAGCACAGATTTTTGGGGG + Intergenic
998638821 5:143986576-143986598 GTGAAAGTCAAAACATTTAGTGG + Intergenic
1000217678 5:159179028-159179050 GTGAAAGCCAGATCATTTGGTGG - Intronic
1000343865 5:160298073-160298095 GTTAAAGCCTTAATATTTTGCGG - Intronic
1000954612 5:167528128-167528150 GTGAAAGCCTGACGATTTGGAGG + Intronic
1002464564 5:179400321-179400343 GTGAAAGCCCCAAATCTTGGTGG + Intergenic
1003030139 6:2594434-2594456 GGGAATGCCCAACTATTTTGAGG + Intergenic
1003834485 6:10055565-10055587 GTGAATTCCTAAATATTTGAAGG - Intronic
1005218056 6:23554716-23554738 GTGCAAGCCCCAAGCTTTGGTGG - Intergenic
1006237093 6:32643039-32643061 GTGAGAGGAGAAATATTTGGAGG - Exonic
1007134358 6:39507304-39507326 GAAAAATCCCACATATTTGGGGG + Intronic
1008369657 6:50717954-50717976 GTGAAAGTCCAATGGTTTGGAGG + Intronic
1009554767 6:65148859-65148881 GTGAAAGCCCCAAGCTTTGGTGG - Intronic
1010042548 6:71403141-71403163 ATGAAACCACAATTATTTGGGGG - Intergenic
1010539149 6:77069715-77069737 GTGAAAGCCCCAAGTCTTGGTGG - Intergenic
1010605939 6:77889880-77889902 GTGTAAGCCCCAAGACTTGGAGG + Intronic
1011324274 6:86131802-86131824 GTGAAAGATCAAATAGTTGTAGG + Intergenic
1015308640 6:131739445-131739467 ATGAAAGTCCAAACATTTTGTGG + Intronic
1016126304 6:140408396-140408418 GTGCAAGCCCAAAATCTTGGAGG + Intergenic
1017145050 6:151227291-151227313 GTGAAATAATAAATATTTGGGGG - Intergenic
1017249943 6:152269512-152269534 GGGAAAACCCATATATTTAGAGG + Intronic
1019119010 6:169788590-169788612 ATGAATGCTCAAGTATTTGGGGG - Intergenic
1020581769 7:10011707-10011729 GTGCAAGCCCCAAACTTTGGTGG + Intergenic
1020659642 7:10966593-10966615 TTGAAAGCCCATCTAATTGGTGG + Intergenic
1021214235 7:17896541-17896563 TTGAGACCCCAGATATTTGGAGG - Intronic
1021895628 7:25232599-25232621 GAGAAAGCTCATCTATTTGGAGG - Intergenic
1023639973 7:42247640-42247662 TTGAAAGCCCAAGTGTTAGGAGG + Intergenic
1024388274 7:48778520-48778542 GTGAAAACCCAAAGATTTATAGG + Intergenic
1024878937 7:54062767-54062789 TTGAAAGAGCAAATATTTGAGGG - Intergenic
1025723391 7:64036614-64036636 GAGAAAGCCCCAATATTTCCAGG - Intronic
1026455216 7:70566130-70566152 GTGAAAGTGCTATTATTTGGAGG - Intronic
1027560242 7:79719726-79719748 GTGAAAGCCCCAAGCCTTGGTGG - Intergenic
1030064391 7:105648292-105648314 GAGAAAGCCCAAAGCTTTTGAGG - Intronic
1031713161 7:125074810-125074832 TTGAAAGCACAAAGACTTGGTGG + Intergenic
1032346305 7:131119711-131119733 GTGTAAGCCCCAAGTTTTGGTGG - Intronic
1034643064 7:152620362-152620384 GTAAAAGTCCCAATATTTGTTGG + Intergenic
1035041430 7:155930904-155930926 GTGAAAGTGCCAATATTTGCTGG - Intergenic
1035250398 7:157593453-157593475 ATGAAAGAACACATATTTGGGGG + Intronic
1037658651 8:20908539-20908561 GTGGGAGCACAAGTATTTGGTGG + Intergenic
1039309219 8:36297662-36297684 GTGCAAGCCCCAAGCTTTGGAGG + Intergenic
1040344039 8:46469013-46469035 GTGAAACACCAAATATTTGGGGG - Intergenic
1040945915 8:52883820-52883842 GTGCAAGCCCCAAGACTTGGTGG - Intergenic
1042013422 8:64277480-64277502 GTGAAACCCCATCTTTTTGGTGG - Intergenic
1042458212 8:69030083-69030105 ATGAAAACCTAATTATTTGGTGG + Intergenic
1044063765 8:87672757-87672779 GTAGAACCTCAAATATTTGGGGG - Intergenic
1044249322 8:89987936-89987958 GAGAATGCCCAAATACTTGGAGG - Intronic
1046533065 8:115472297-115472319 GTGCAAGCCCCAAGACTTGGTGG - Intronic
1048617716 8:136096069-136096091 TTGAAAGAGAAAATATTTGGAGG - Intergenic
1050423430 9:5490428-5490450 GTGGGAGGGCAAATATTTGGAGG - Intergenic
1051743908 9:20276814-20276836 GTGCAAGCCCCAAACTTTGGTGG - Intergenic
1052466998 9:28841083-28841105 TTGAAAGCGTAAACATTTGGAGG - Intergenic
1052608405 9:30735473-30735495 ATGAAAGTACAAATATCTGGGGG + Intergenic
1052721249 9:32173642-32173664 GTGACATCTCAAATATTTAGGGG - Intergenic
1053168936 9:35864692-35864714 TTAAAAGCCAAAATATTTGCTGG - Intergenic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1054797162 9:69313236-69313258 GTGCAAGCCCCAAGACTTGGTGG - Intergenic
1057233280 9:93338509-93338531 GTGAAAGCCCCAAGCCTTGGTGG + Intronic
1185689884 X:2145567-2145589 GTGAAACCCCAAAAATTAGCTGG + Intergenic
1186294729 X:8136573-8136595 GTGACAGACCACATATTTGATGG + Intergenic
1186827221 X:13352281-13352303 GTAAAAGCACTAAGATTTGGGGG + Intergenic
1187408104 X:19022615-19022637 GTGCAACCCCAAATAATTGTTGG + Intronic
1187615787 X:20991840-20991862 GTGAAAGCCCCAAGCCTTGGTGG - Intergenic
1189652754 X:43208091-43208113 GTGCAAGCCCCAAGACTTGGTGG + Intergenic
1193027087 X:76856084-76856106 GTGCAAGCCCCAAGACTTGGTGG - Intergenic
1193236637 X:79114635-79114657 GTGCAAGCCCAAAGCCTTGGAGG - Intergenic
1193981333 X:88185442-88185464 GTGCAAGCCCCAAGCTTTGGTGG + Intergenic
1194043341 X:88970652-88970674 GTGCAAGCCCAAAAGTTAGGTGG - Intergenic
1194607041 X:95993443-95993465 GATATAGCCCAAACATTTGGAGG + Intergenic
1194881182 X:99253764-99253786 GTGTAAGCCATAATCTTTGGTGG - Intergenic
1194914003 X:99682697-99682719 GTGAAAGCCACAATGTTTGTGGG + Intergenic
1195399998 X:104451242-104451264 GTGAGAGCCCCATAATTTGGTGG + Intergenic
1196190618 X:112790647-112790669 GTGGGAGCAGAAATATTTGGAGG - Exonic
1196245852 X:113399652-113399674 ATGAGAGTTCAAATATTTGGTGG - Intergenic
1197641997 X:128977128-128977150 TTGAAAGCCCAACTATCTAGGGG - Intergenic
1198304657 X:135368605-135368627 GTGCAAGCCCAAAGCCTTGGTGG - Intergenic
1199117404 X:144008730-144008752 GTGCAAGCCCCAAGACTTGGTGG - Intergenic
1199200856 X:145087694-145087716 TTGAAAGCCCTAAGACTTGGAGG + Intergenic
1199370475 X:147042268-147042290 GTGAAAGCCCCAAGTCTTGGTGG + Intergenic
1200268891 X:154662669-154662691 GTGCAAGCCCCAAAACTTGGTGG + Intergenic
1200395399 X:155983630-155983652 GTGAAAGCCCCAAGTCTTGGTGG + Intergenic