ID: 929067749

View in Genome Browser
Species Human (GRCh38)
Location 2:37996951-37996973
Sequence CTCTGGGTCAGGAGGCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929067742_929067749 8 Left 929067742 2:37996920-37996942 CCCTATTCTATTTACATATCTGA 0: 1
1: 0
2: 2
3: 26
4: 374
Right 929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG 0: 1
1: 0
2: 3
3: 25
4: 292
929067741_929067749 25 Left 929067741 2:37996903-37996925 CCTTCTGGCTTGAGGATCCCTAT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG 0: 1
1: 0
2: 3
3: 25
4: 292
929067743_929067749 7 Left 929067743 2:37996921-37996943 CCTATTCTATTTACATATCTGAG 0: 1
1: 0
2: 1
3: 36
4: 258
Right 929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG 0: 1
1: 0
2: 3
3: 25
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929067749 Original CRISPR CTCTGGGTCAGGAGGCCAGT TGG Intronic
900471765 1:2858449-2858471 CTTGGGGTCAGGGAGCCAGTGGG - Intergenic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900895037 1:5477547-5477569 GACTGAGTCAGGAGGACAGTGGG - Intergenic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901048936 1:6416507-6416529 GCCTGAGTCAGGAGGTCAGTGGG - Exonic
901689533 1:10963833-10963855 GGCTGGCTCAGGGGGCCAGTCGG - Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902564785 1:17304357-17304379 CTCTGGGACAGGAGCTCAGGTGG + Intergenic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903129838 1:21271665-21271687 CACTGGGGGAGGAGCCCAGTGGG + Intronic
903551767 1:24162094-24162116 CTCTAGGTCAGAAGTCCAGGTGG + Intronic
904391243 1:30187664-30187686 CTTTGGGCCAGAAGTCCAGTGGG + Intergenic
904900721 1:33855095-33855117 CTCTGGGTGAAGAGGCTTGTGGG + Intronic
905724293 1:40236084-40236106 CTCAGGATCAAAAGGCCAGTGGG - Exonic
906054715 1:42906468-42906490 CTCTGAGTCAACAGGCCAATAGG - Intergenic
906644734 1:47466229-47466251 CACTGGGTCAGGAGGTAAGCAGG - Intergenic
907273609 1:53304869-53304891 GTCTGGGCCAGGATGCCAGTGGG - Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
908246281 1:62229840-62229862 CTCTGGGTTAGGCAGCTAGTGGG - Intergenic
912861468 1:113217626-113217648 GTCTGGGTCAGGAGCACAGGAGG + Intergenic
914716313 1:150257653-150257675 CCCTGGCTCAGGAGCCCAGCTGG - Exonic
914828875 1:151156336-151156358 TTCTGGGGTAGGAGGTCAGTGGG - Intergenic
916475282 1:165162987-165163009 CTCTGGTGCCGGAGGCCAGGAGG - Intergenic
919536277 1:198791682-198791704 CACTGGGTCAGGAGCGAAGTGGG - Intergenic
920046135 1:203133756-203133778 CCCCGGGTCAGCAGCCCAGTGGG - Intronic
920186342 1:204161680-204161702 CTCTGGGGCAGGAAGCCATCAGG + Intronic
920252164 1:204629023-204629045 CTCTGCGTCAGGAGTCAGGTGGG + Intronic
920444280 1:206003607-206003629 CTATGGGTCAGGGGGCCTGCAGG + Intergenic
920576559 1:207065127-207065149 GTCTGGGTCAAGAGGTCGGTAGG - Exonic
921031166 1:211336319-211336341 CTCTGGGTGAGGTGCCAAGTGGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
923347226 1:233066350-233066372 CTCTGGCTCAGGAAGCCTGGAGG - Intronic
924455747 1:244217648-244217670 CTTTGGGCCAGGACACCAGTGGG + Intergenic
924570669 1:245234942-245234964 CACAGGGGCAGGAGGCCAGGAGG - Intronic
1062855331 10:777311-777333 CGCTGGGGAAGGAGGCCTGTGGG - Intergenic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065122434 10:22542867-22542889 CACGGGGTCAGGGAGCCAGTTGG - Intronic
1065920527 10:30388611-30388633 CTCTGGGACACGAGCTCAGTGGG + Intergenic
1067332203 10:45333091-45333113 CTCCCGGTCAGGAGGCCAGGGGG + Intergenic
1067432743 10:46254588-46254610 CTATAGGTTAGGAGGCCAGGGGG - Intergenic
1069822176 10:71234963-71234985 TTCTGGGCCAGGAGACCAGTGGG - Intronic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070416836 10:76198330-76198352 GCCTGGGGCAGAAGGCCAGTGGG + Intronic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070532211 10:77346906-77346928 TTCTTGGTCAGCAGGGCAGTCGG - Intronic
1071198758 10:83192771-83192793 ACCTGGGGCAGGAGTCCAGTGGG - Intergenic
1072633999 10:97165688-97165710 CTCTGGGTCAGGAGGATGGGGGG + Intronic
1072757909 10:98032589-98032611 CTCTGCATAAGGAGTCCAGTTGG + Intergenic
1072916605 10:99540765-99540787 TTCTGGTTCAGGACGCCAGTGGG + Intergenic
1075331730 10:121578933-121578955 TTCTGGGTCAGTAGGCCTGCAGG + Intronic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1075930437 10:126290354-126290376 CTCAAGGTCAGAAGCCCAGTGGG - Intronic
1076033603 10:127180008-127180030 CTCAGAGTGAGGAGGCTAGTGGG + Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076258102 10:129044839-129044861 TTCAGAGCCAGGAGGCCAGTGGG + Intergenic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1079689461 11:23403704-23403726 CCCTGGAGCAGGTGGCCAGTTGG + Intergenic
1080643003 11:34168789-34168811 CCCTGGGTTAGGTGGGCAGTTGG + Intronic
1080695602 11:34600691-34600713 CACTGGGTCATGGGCCCAGTGGG - Intergenic
1081030458 11:38074334-38074356 CTTTCGATCAGGAGGACAGTAGG - Intergenic
1081815227 11:45935448-45935470 CTCAGGTACAGGCGGCCAGTTGG - Intronic
1081966514 11:47173409-47173431 CACTGGGTCAGTATGCCAGCGGG - Exonic
1082081140 11:48013434-48013456 CTCGGGATCTGAAGGCCAGTGGG + Intronic
1082771151 11:57208597-57208619 CTCTGGGTAAGGAGGCAGATTGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083994710 11:66266262-66266284 CTCTGGGTCAGGAGCTCATCCGG - Intronic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1084786268 11:71443489-71443511 CTCTGGACTGGGAGGCCAGTGGG + Intronic
1084787748 11:71453262-71453284 CGCTTGGGCAGGAGGCCAGCGGG - Exonic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1087291069 11:96321112-96321134 TTCAGGGTCACGAGCCCAGTGGG - Intronic
1087318877 11:96636023-96636045 TTCTGGGTCAGGAGGGGACTTGG + Intergenic
1088656618 11:112005921-112005943 CTTGAGGTCAGGAGGACAGTGGG + Intronic
1088717121 11:112558681-112558703 CTGTGGGTCAGGAAGCCAAGTGG + Intergenic
1089498595 11:118920007-118920029 CTCTGGGACCAGAGGCCACTGGG + Intronic
1089775431 11:120832232-120832254 CACTGGGGCAGCAGGGCAGTAGG + Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090671003 11:128945307-128945329 CTCTGGGGCAGGTGGGCTGTGGG - Intergenic
1092698317 12:11199266-11199288 CTCAGCAGCAGGAGGCCAGTAGG - Intergenic
1094662981 12:32489221-32489243 CTCCTGGACAGGAGTCCAGTTGG - Intronic
1096867838 12:54575769-54575791 TCCTGGGTTAGGAGGCCAGGGGG + Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098139044 12:67432843-67432865 CTCAGAGTAAGGAGGCCACTTGG - Intergenic
1102169217 12:110829323-110829345 CTCAGGATCAGGCGGACAGTCGG - Intergenic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104018213 12:124974481-124974503 CCCCGGGTCAGCATGCCAGTTGG - Intronic
1105413561 13:20191635-20191657 CCCAGGGTCGGGAGGCCAGGAGG - Intronic
1106122330 13:26870875-26870897 CACTTGGCCAGGAGGCCAGAGGG - Intergenic
1106457647 13:29941271-29941293 CTCTGAATCAGGATGCCAGGAGG + Intergenic
1107985811 13:45775388-45775410 CTCTCTGCAAGGAGGCCAGTGGG - Intergenic
1112086201 13:96034594-96034616 CTCTGGCTCAGGGAGCCTGTAGG - Intronic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1114600521 14:23952669-23952691 GTCTGGCTTTGGAGGCCAGTGGG + Intergenic
1114604755 14:23987813-23987835 GTCTGGCTTTGGAGGCCAGTGGG + Intronic
1114610204 14:24035374-24035396 GTCTGGCTTAGGAGGCCAGTGGG + Intergenic
1116761465 14:49020223-49020245 CTCTAGGTCAGAAGCCCAGGTGG - Intergenic
1116855296 14:49946691-49946713 TTCTGAGTGAGGAGGCCTGTGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118704865 14:68471350-68471372 CTCCGGGCTAGCAGGCCAGTAGG - Intronic
1118746435 14:68776876-68776898 ATCTGGCACAGGAGCCCAGTGGG + Intergenic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1120118404 14:80648186-80648208 CTCTGAGTCAGGAGAGCAGTTGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120715216 14:87834210-87834232 CTTGAGGTCAGGAGGCCAGGAGG + Intergenic
1122147073 14:99697797-99697819 CTCTGGGACAGCAGGCCATGGGG + Intronic
1122288700 14:100667993-100668015 CTCTGGGTCCTGAGGCCAAGCGG - Intergenic
1123413889 15:20081351-20081373 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1123523231 15:21088462-21088484 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1124787149 15:32692088-32692110 CCCAGGGTCTGTAGGCCAGTGGG + Intronic
1126103630 15:45134324-45134346 CTCTGGGGAAGGAAGCCGGTGGG + Intronic
1126200417 15:45979194-45979216 CTTTGGGTCAGAAGACCAGCAGG - Intergenic
1126901961 15:53323535-53323557 TACTGGGTTAGGGGGCCAGTGGG + Intergenic
1127458780 15:59179005-59179027 ATCTGGGTCACGAGGCCCTTGGG + Intronic
1128107137 15:65053479-65053501 CTGTGGGTCGGGAAGCCTGTAGG + Exonic
1128652352 15:69427596-69427618 CTCTTGGTCGATAGGCCAGTAGG + Intronic
1131153199 15:90059663-90059685 CTCTGGCTCCTGAGGCCTGTGGG + Intronic
1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG + Intergenic
1131514801 15:93070152-93070174 CACTGAGTCAGGAACCCAGTAGG + Intronic
1131910965 15:97200925-97200947 CACAGGGGAAGGAGGCCAGTGGG - Intergenic
1132746830 16:1439678-1439700 CTGGGGGGCAGGAGGCCAGCAGG - Intronic
1132751927 16:1461572-1461594 CTCAGGGTCAGGGGGACAGAAGG + Intronic
1133873215 16:9708986-9709008 ACCTAGGTCAGGAGGCCAGAAGG + Intergenic
1134510669 16:14844446-14844468 CTCTGGGGCAGGAAACCAGGAGG + Intronic
1134698308 16:16242932-16242954 CTCTGGGGCAGGAAACCAGGAGG + Intronic
1134973526 16:18551745-18551767 CTCTGGGGCAGGAAACCAGGAGG - Intronic
1135201290 16:20439831-20439853 CTCTGGGTCATGAGAGGAGTAGG - Exonic
1135217817 16:20588033-20588055 CTCTGGGTCATGAGAGGAGTAGG + Intergenic
1135469923 16:22721292-22721314 CCCTGGGGAAGGAGGCCAGGTGG + Intergenic
1137546754 16:49410160-49410182 CTGTGGGTCAGGAACACAGTGGG + Intergenic
1137594853 16:49716754-49716776 CTCTGAGCCACTAGGCCAGTGGG + Intronic
1137753759 16:50885667-50885689 TCATAGGTCAGGAGGCCAGTAGG - Intergenic
1138487767 16:57357847-57357869 CTCAGGGGAAGGAGACCAGTGGG + Intergenic
1138493939 16:57395592-57395614 CTCTGGGCCAAAGGGCCAGTGGG + Intergenic
1138552979 16:57757359-57757381 CTCTGGGCCATGTGGCCAGCAGG + Intergenic
1139310257 16:66022079-66022101 CTCTGGTTCAGAAGGTCAGGGGG - Intergenic
1140252468 16:73306143-73306165 CTCTAGGGCAGGAGAACAGTAGG - Intergenic
1140473472 16:75227293-75227315 CTCTGGGAGAGGAGGTGAGTGGG + Intergenic
1141378105 16:83550236-83550258 CTCTTGGTCAGCTGGCCAGCAGG + Intronic
1141964777 16:87434462-87434484 CGCTGGGTCTGGAGGCCACCTGG + Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1143875796 17:9989904-9989926 CTTGGGGTCAGGAAGTCAGTGGG + Intronic
1147692251 17:42323465-42323487 CTCTTGGTCCAGCGGCCAGTAGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148360644 17:47009706-47009728 CCCTGGGACAGGAGGCCTGCCGG - Intronic
1148746115 17:49919474-49919496 CTTTGGGTTAGGAACCCAGTTGG + Intergenic
1149464387 17:56864185-56864207 CTCTGGGTCAGCCGACCTGTGGG - Exonic
1149541730 17:57472585-57472607 CTCAAGGTCATGAGGCCAGTTGG - Intronic
1151453096 17:74211360-74211382 CTCTGGGTCAGCAGGCCTCCGGG + Intergenic
1151802828 17:76387747-76387769 TCCTGGGTCAGGAGCCCAGCTGG + Exonic
1151894376 17:76970059-76970081 CACTGGGTCAAGTGGCCAGCTGG + Intergenic
1152239814 17:79155376-79155398 CTCTCGGGCAGGAAGCCAGTGGG + Intronic
1152578785 17:81156945-81156967 CCCTGTGTCGGGAGGCCTGTGGG - Intronic
1152772693 17:82179921-82179943 CTCTGGGACAGAAGGCCATGGGG + Intronic
1153635901 18:7113332-7113354 CTCTGAGACAGCAGGCCAGCTGG + Intronic
1157331293 18:46705624-46705646 CTCTGCCACAGGAGGCCAGAGGG - Intronic
1157347941 18:46857122-46857144 CTCTTGGTAAGGAGAACAGTGGG - Intronic
1161956723 19:7500214-7500236 CTCTAGGCCTGGAGGCCAGCAGG - Intronic
1162274255 19:9640390-9640412 GTCTGGCTCATGAAGCCAGTGGG + Intronic
1162719778 19:12655601-12655623 CTCTGGGTCAGCAGGTCCCTAGG - Intronic
1163154153 19:15431076-15431098 CCCTGGAGCAGGTGGCCAGTCGG - Intronic
1163277729 19:16296015-16296037 CTCTGGACCAGGAGGCCAAGTGG + Intergenic
1163533296 19:17863067-17863089 CTCTGACGCAGGAGCCCAGTGGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166118027 19:40667597-40667619 CGCTGGCTCAGGGGGCCAGGGGG + Exonic
1166390563 19:42406865-42406887 CTGTGGGCCAGGAGGCTGGTAGG + Intronic
1167781049 19:51599001-51599023 TTCTGGGTCAGGTGGGCACTTGG + Intergenic
925378445 2:3406021-3406043 CTCTGGGGCAAGAGGCCTGAGGG - Intronic
927647263 2:24885913-24885935 GCCGAGGTCAGGAGGCCAGTTGG - Intronic
928454031 2:31403283-31403305 CTCTGAATAAGGAGGCCAGTGGG - Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
930696350 2:54415955-54415977 CTCAGGCTCAGGAGGACAGCAGG - Intergenic
931833108 2:66072706-66072728 CCCTGAGACAGGAGGCCAGGTGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936894978 2:117417211-117417233 CTCTAGGTAAGGGGGCCTGTGGG + Intergenic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
937875890 2:126825004-126825026 AGCTGGGGCAGGAGGCCCGTGGG + Intergenic
937976057 2:127582689-127582711 CTCTGGCTCATGAGGACAGCAGG - Intronic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
946967726 2:225055642-225055664 CCCTAGGTCAGAAGGGCAGTGGG - Intergenic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948876762 2:240833505-240833527 CTCGGGGTCAGGTGTACAGTGGG + Intergenic
948906839 2:240983708-240983730 CTCAGGGTCAGGACGCCCGCAGG + Intronic
949054695 2:241921568-241921590 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054706 2:241921608-241921630 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054717 2:241921648-241921670 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054739 2:241921728-241921750 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054764 2:241921808-241921830 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054775 2:241921848-241921870 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054787 2:241921889-241921911 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054799 2:241921929-241921951 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054811 2:241921969-241921991 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054833 2:241922049-241922071 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054868 2:241922168-241922190 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
949054901 2:241922287-241922309 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054912 2:241922327-241922349 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
949054925 2:241922367-241922389 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
949054944 2:241922430-241922452 CCCTGGGACAGGAGGCCAGGAGG + Intergenic
1169674938 20:8142915-8142937 CTCAGGGGCAGGAGGGCAGCTGG - Intronic
1171006154 20:21467564-21467586 CTCTTCGTCAGGAGGACACTGGG + Intergenic
1173191911 20:40883275-40883297 CTCTGGGCCAGGAATCCAGCCGG - Intergenic
1174842351 20:53912146-53912168 CCCTGGGCCTGCAGGCCAGTTGG + Intergenic
1175287898 20:57850017-57850039 GTCTGGGTTAGGAAGCCAGAAGG + Intergenic
1176169169 20:63689359-63689381 CTGTGGGTCAGGACCCCACTTGG - Intronic
1176375897 21:6086740-6086762 TGCTGGGTCAGGAGACCGGTCGG + Intergenic
1179747578 21:43451504-43451526 TGCTGGGTCAGGAGACCGGTCGG - Intergenic
1181895823 22:26106609-26106631 CCCTGGGGCAGGAGGCAAATTGG - Intergenic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1182485079 22:30634701-30634723 CTCTTGGGCAGGAGCCTAGTAGG + Intergenic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182521283 22:30885856-30885878 CCCACGGTCAGGATGCCAGTTGG - Intronic
1182546230 22:31078217-31078239 CCTTGGGTCAGGAGGCAAGAAGG - Intronic
1183281171 22:36933464-36933486 CTCAGGGTCCAGAGTCCAGTCGG + Intronic
1183958742 22:41398125-41398147 CTCTGAGTCAGGAGCCTGGTGGG + Exonic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1185134288 22:49060316-49060338 CTCTGGGGCAGGAGGGCTGGAGG - Intergenic
950249922 3:11456148-11456170 CTCAGGGTTAGGGGGCCAGAGGG - Intronic
950577135 3:13838689-13838711 CTCTGGGTCCCTAAGCCAGTTGG - Intronic
950714474 3:14837974-14837996 CTGTGGGTCAGCAGTCTAGTGGG + Intronic
953785989 3:45911624-45911646 CCCTGAGTCAGGAGGACAGGGGG + Intronic
957782340 3:84835370-84835392 TTCTGGGTCAGGTGGCGACTTGG - Intergenic
959592664 3:108097090-108097112 CTGTAGGTCAGAAGTCCAGTAGG + Intergenic
962435424 3:135362074-135362096 CTCTGGGTCATGATGCCTTTGGG + Intergenic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
963935403 3:151047060-151047082 CTGTAGGTCAGAAGTCCAGTGGG - Intergenic
964400189 3:156290599-156290621 CTCCAGGTCAGGTGGGCAGTAGG - Intronic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
967048328 3:185758001-185758023 TTCTTGGTCAGGTGGCCAGTTGG - Intronic
969890660 4:10256834-10256856 CTCAAGGTCAGGAAGTCAGTTGG - Intergenic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
970569615 4:17366853-17366875 CTATGGGTCAGGAACCCAGGCGG - Intergenic
977251333 4:94692696-94692718 CGCTGGATCAGGAGCACAGTGGG - Intergenic
978344174 4:107748998-107749020 CTTTGGGTCAGGTGCTCAGTTGG + Intergenic
979069944 4:116189530-116189552 CTCTGGGAAATAAGGCCAGTAGG + Intergenic
980922324 4:139099352-139099374 CTCAGGGCCAGGAACCCAGTAGG - Intronic
982584721 4:157222249-157222271 TGCTGGGGCAGGAGGCCACTGGG - Intronic
982804551 4:159748102-159748124 GTCTGGGTCAGCAGGTGAGTGGG + Intergenic
987255739 5:16149145-16149167 CACTGGGTAAGGAGGACACTGGG - Intronic
987346742 5:16985629-16985651 TTCTGGGTCAGGTGGGGAGTTGG - Intergenic
990645310 5:57837129-57837151 CTCTGAGTCAGCAGACCAATGGG - Intergenic
992052571 5:72955339-72955361 CTATGGGTCAGGAAGTCCGTCGG + Intergenic
992476043 5:77102628-77102650 CACTGTGTCAGGAGCCCTGTGGG - Intergenic
993812491 5:92499160-92499182 TTCTGTGTCAGGGGACCAGTGGG - Intergenic
997209412 5:132068676-132068698 GTCTGGGTCAAGATGCCAGGTGG - Intergenic
997740438 5:136248253-136248275 CTCAGAGTCATGTGGCCAGTAGG - Intronic
998386517 5:141760225-141760247 CTGTGGGGCAGGGGGCCGGTGGG + Intergenic
998601833 5:143592609-143592631 GGCTGGGACAGGAGCCCAGTGGG - Intergenic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999648556 5:153743331-153743353 CTATAGGTCAGAAGTCCAGTAGG + Intronic
1001445873 5:171782521-171782543 CCCTGGGTCAGGCGCACAGTAGG + Intergenic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1003723204 6:8729122-8729144 ACCTGGGCCAGGAGGCCAATAGG - Intergenic
1003765676 6:9233696-9233718 CTCTGGATCAGGAGGTCATTAGG + Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1005395342 6:25376959-25376981 CTCTGGGTCAGGAGTGTAATTGG - Intronic
1005922667 6:30415839-30415861 TCCTGGGTCATGAGGCCAGGAGG - Intergenic
1007476332 6:42122264-42122286 CTCTGGGGCAAGAAGTCAGTAGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008536416 6:52509463-52509485 CGCTGGGACAGGAAGGCAGTGGG + Intronic
1009883938 6:69602372-69602394 CTTTGGGCCAGGAGGCCGGCAGG + Intergenic
1010462817 6:76132636-76132658 CTCTGGGGCAGGTGGCCTTTGGG - Intergenic
1011519923 6:88194258-88194280 CTCTGGATAAGGAGGTCGGTGGG + Intergenic
1011825718 6:91303274-91303296 TTCTGGGTCAGGTGGCGACTTGG - Intergenic
1012307333 6:97675084-97675106 CCCTGGATCAGCAGGCGAGTGGG + Intergenic
1013551216 6:111209600-111209622 CTGTGGGTTAAGAGGCCTGTGGG + Intronic
1013551220 6:111209616-111209638 CTGTGGGTTAGGAAGCCTGTGGG + Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016302443 6:142647292-142647314 CTATGGCTCAGGAGGGCATTTGG + Intergenic
1019398594 7:837123-837145 CCCTGGGGCAGCAGGACAGTGGG + Intronic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1021769558 7:23984863-23984885 CTCTGGGTCTAGCTGCCAGTGGG - Intergenic
1022506036 7:30909091-30909113 CATTGGGGCAGGAGGCCAGGGGG - Intergenic
1026194737 7:68163179-68163201 TTCTAGGGCAGGAGGCCAGGAGG - Intergenic
1029476968 7:100791028-100791050 TTCTGGGTCAGGGCGCCACTGGG - Exonic
1029572525 7:101379615-101379637 ATCTGGGTAAGTAGCCCAGTAGG - Intronic
1032600058 7:133284274-133284296 CTCTTGATCAGGAGCCTAGTTGG + Intronic
1034075296 7:148225638-148225660 CTCAGGGTCAGAGGCCCAGTGGG + Intronic
1034941591 7:155234182-155234204 CTCTCGGTCAGAAGGCCATTCGG - Intergenic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1037468271 8:19182242-19182264 ATCTGGATAAGGAGCCCAGTTGG - Intergenic
1037757734 8:21722240-21722262 TTCTGGCTCAGGTGGCCAGGAGG - Intronic
1037921775 8:22811666-22811688 CTCTGGTTCAGGAGGTCACAGGG + Intronic
1037960368 8:23093017-23093039 CTCTGGGGAAGGTGGACAGTGGG - Intronic
1040443771 8:47472435-47472457 TTCTGGGTTAAGGGGCCAGTGGG + Intronic
1040869247 8:52083323-52083345 CCCTGGGACAGGAACCCAGTTGG + Intergenic
1040999547 8:53437397-53437419 TTCTGGGTCAGGAGGGGACTTGG - Intergenic
1047490834 8:125373434-125373456 ATTTGAGTCAGGAGGCCAGCTGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049347947 8:142148663-142148685 CTCTGGGGCCGAAGGCCAGATGG + Intergenic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1051356075 9:16240665-16240687 CTCTGGGACAGGAGACCATAGGG + Intronic
1053192717 9:36086729-36086751 CTCTGGGTCAGGTGGGGACTTGG - Intronic
1056570458 9:87810186-87810208 CTGTAGGTCAGAAGTCCAGTCGG - Intergenic
1060876810 9:127089832-127089854 CTCTGTGGCAGGAGGACAGGGGG + Intronic
1060954608 9:127629593-127629615 TTCTGGCTCGGGCGGCCAGTTGG + Intronic
1060978443 9:127778927-127778949 CTCTGGGAACGGAGCCCAGTGGG + Intergenic
1061003428 9:127915446-127915468 ATCTGGGTCAGCAGGCCAGGTGG + Intronic
1061179301 9:129014372-129014394 GCCTGGGCCAGGAGGCCAGCGGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1186645661 X:11504686-11504708 TTCTGGCTCAGTAAGCCAGTGGG - Intronic
1187293567 X:17977851-17977873 CCCTGGCATAGGAGGCCAGTAGG + Intergenic
1188741651 X:33790751-33790773 CCCTGGGACAGGAGGGGAGTTGG - Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1190054796 X:47175268-47175290 CTCTGGATGAGAAGCCCAGTGGG - Intronic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192349639 X:70346739-70346761 CTCTGATTCAGGAGTCCAGCAGG - Intronic
1192547860 X:72028528-72028550 ATCTGGGGAAGGAGGCCAGGCGG - Intergenic
1195703094 X:107719595-107719617 CTCTGGGTCAGGAAGACCCTGGG - Intronic
1197892134 X:131278544-131278566 CTCTGGGTCAGGGCGCCAAGGGG + Exonic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200102256 X:153694030-153694052 CTCTGGGACAGGGAGCCAGGAGG + Intronic
1200138879 X:153887500-153887522 GCCTGGGTCACGAGGCCAGCAGG + Intronic