ID: 929072259

View in Genome Browser
Species Human (GRCh38)
Location 2:38044498-38044520
Sequence ACATATGCATAATGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929072259_929072266 23 Left 929072259 2:38044498-38044520 CCCATTTCCCATTATGCATATGT 0: 1
1: 0
2: 3
3: 19
4: 235
Right 929072266 2:38044544-38044566 AGTTGTTATATGTTCTGTTTGGG 0: 1
1: 1
2: 6
3: 37
4: 349
929072259_929072265 22 Left 929072259 2:38044498-38044520 CCCATTTCCCATTATGCATATGT 0: 1
1: 0
2: 3
3: 19
4: 235
Right 929072265 2:38044543-38044565 CAGTTGTTATATGTTCTGTTTGG 0: 1
1: 0
2: 2
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929072259 Original CRISPR ACATATGCATAATGGGAAAT GGG (reversed) Intronic
905917181 1:41693561-41693583 ACATAGGCATGATGGGTAAAAGG - Intronic
906527302 1:46502189-46502211 ACATATGCTTACTTGGAAGTTGG + Intergenic
906773841 1:48510681-48510703 ACCTAAGCATGATGGGAAAAGGG + Intergenic
908845533 1:68320684-68320706 ACACATGGGGAATGGGAAATTGG + Intergenic
909148902 1:71975209-71975231 ATATATGCTTAATGGGAAGTAGG + Intronic
910674624 1:89804126-89804148 TCATCTGCAAAATGGGAAAGAGG - Intronic
911283122 1:95956094-95956116 ACATAAGCAAAATAGGAAAGAGG - Intergenic
912273161 1:108230289-108230311 AGAAATGCAAAATGGGAAAGGGG + Intronic
912273174 1:108230414-108230436 AGAAATGCAAAATGGGAAAGGGG + Intronic
912283041 1:108337819-108337841 ACTTAAGCAAAATGGAAAATTGG + Intergenic
912295046 1:108463908-108463930 AGAAATGCAAAATGGGAAAGGGG - Intronic
912295059 1:108464033-108464055 AGAAATGCAAAATGGGAAAGGGG - Intronic
912413298 1:109492170-109492192 ACATGTGCATAAGTGGACATGGG - Intronic
913220828 1:116658949-116658971 TCGTCTGGATAATGGGAAATGGG + Intronic
915629868 1:157144707-157144729 ACATCTGCATAATGAGAAGCTGG - Intergenic
917583327 1:176397823-176397845 ATAAGTGCATAATGGGGAATGGG + Intergenic
918251135 1:182704541-182704563 CCATATGCAGAATGGGACAAAGG + Intergenic
918364842 1:183796796-183796818 ACATCTGCAGAATGGGAGCTGGG - Intronic
918649721 1:186946479-186946501 TCATATACATAATGGGCATTTGG + Intronic
921323912 1:213971772-213971794 ACAGAGGCATAATGCAAAATGGG + Intergenic
921659480 1:217783641-217783663 ACCTTTGCATCATTGGAAATAGG - Intronic
922626450 1:227049831-227049853 TGTTATGTATAATGGGAAATGGG - Intronic
922712860 1:227846072-227846094 ACATATCCATTTTGAGAAATAGG - Exonic
1064292557 10:14049260-14049282 ACATATGCACAGTGGGGATTTGG + Intronic
1065294433 10:24261091-24261113 ACATATGTATAATGGCAAAGAGG - Intronic
1065947950 10:30624559-30624581 ACAAATGCAAACTGGGTAATTGG - Intronic
1066093106 10:32045629-32045651 ACATTTTCAAAATGGGAAAAGGG + Intronic
1068437076 10:57006151-57006173 AGATATGGAGAATGGGAAATCGG + Intergenic
1068749298 10:60573313-60573335 AAATATGAATCATGGCAAATTGG - Intronic
1069178120 10:65320507-65320529 ACATTTGCATAGTGGGAGAACGG + Intergenic
1071112441 10:82175502-82175524 GCATTTGGATAAAGGGAAATTGG - Intronic
1071763923 10:88640424-88640446 ACATATGGATAATGTCAACTTGG - Intergenic
1072486370 10:95860018-95860040 ACATATTCATTATAGAAAATAGG + Intronic
1073897110 10:108174895-108174917 ACATATGAAAAATGAGTAATGGG - Intergenic
1074384336 10:113005215-113005237 ACACATTCATAATGGGCCATTGG - Intronic
1076059851 10:127405285-127405307 TCATGTGAATACTGGGAAATGGG - Intronic
1077759628 11:5078452-5078474 ACATTTCCCCAATGGGAAATAGG + Intergenic
1079450105 11:20593461-20593483 ATATATTTATTATGGGAAATAGG - Intergenic
1079547539 11:21651850-21651872 CCATAACCATAATGGGAAAAGGG + Intergenic
1081040693 11:38206787-38206809 ACATATATATAGTTGGAAATGGG - Intergenic
1082126856 11:48442795-48442817 ACATATCCAAATTGGAAAATAGG - Intergenic
1082579971 11:54854418-54854440 AAAGAAGCATAATGGGAAAATGG + Intergenic
1083657922 11:64238715-64238737 ACCTCTGCATAATGGGATTTGGG + Exonic
1088446741 11:109938541-109938563 ACATTTGCATAATGGGTTATAGG - Intergenic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1092742699 12:11645258-11645280 ACATAGGCTTAACGGTAAATTGG + Intergenic
1093440395 12:19188838-19188860 ATATATACTTAATGGTAAATGGG + Intronic
1093866955 12:24238807-24238829 CCATGTGCAAAATGGGAATTAGG - Intergenic
1094247219 12:28312272-28312294 ATATATGGATAATTCGAAATGGG + Intronic
1094642642 12:32291109-32291131 ACATATGCATAAACAGAACTAGG + Intronic
1097006108 12:55919084-55919106 ACATATGCAAGATGGGAATATGG + Intronic
1097914656 12:65007806-65007828 TCACATCCATAATAGGAAATTGG + Intergenic
1097964012 12:65559864-65559886 ACATTTGCATAATGGGGAGTGGG + Intergenic
1099182896 12:79487941-79487963 ACTTATGCAGAATGGGAATGGGG + Intergenic
1099984919 12:89651166-89651188 TCATATGCATACTGGTCAATAGG - Intronic
1102777048 12:115529157-115529179 ACATATGGAAAATGTTAAATGGG + Intergenic
1104307826 12:127625444-127625466 AAAGATGCATTATGGGAGATTGG - Intergenic
1104477183 12:129080518-129080540 ACATATCCATTCTGGAAAATTGG - Intronic
1104488319 12:129171460-129171482 ACATGTGCTTAATGGCGAATAGG + Intronic
1106293513 13:28388683-28388705 ACATTTGCATATGGGGAAAGTGG + Intronic
1106456154 13:29929179-29929201 CCAGAAGCACAATGGGAAATGGG + Intergenic
1107591232 13:41908862-41908884 ACTTAAGTATAATGGAAAATGGG + Intronic
1107623199 13:42254745-42254767 ACATATGTATAATTCAAAATAGG - Intronic
1109996198 13:70130518-70130540 AGATATGCATAATGTGATGTAGG + Intergenic
1110165659 13:72440115-72440137 ACCTATCCATACTGGGAACTAGG - Intergenic
1110205228 13:72904162-72904184 TCATATGCAGAAAGGAAAATTGG - Intronic
1110656006 13:78000520-78000542 AAAGATGCAGAATGGCAAATTGG + Intergenic
1111864271 13:93749129-93749151 ACATCTGAAGAATGGAAAATGGG - Intronic
1112186228 13:97130378-97130400 ACATCTTCATATTGGGAAATAGG - Intergenic
1112715252 13:102177560-102177582 GCAGATGCAAAATTGGAAATAGG - Intronic
1113214698 13:108025648-108025670 TCATATCAAGAATGGGAAATGGG + Intergenic
1114333835 14:21666013-21666035 TCATATACATAATGGGCACTGGG + Exonic
1114924091 14:27371642-27371664 ACATTTGCATGAGTGGAAATAGG + Intergenic
1116112986 14:40610624-40610646 ACAGATGCAGACTGGCAAATTGG - Intergenic
1117481523 14:56150391-56150413 ACATATGGCTAATAGAAAATGGG - Intronic
1117924050 14:60757728-60757750 ACATATGTAGAATAGGAAATAGG + Intronic
1118253859 14:64187906-64187928 ACTTATGCATAATGGGGTATTGG + Intronic
1119235205 14:73013790-73013812 ACATTTGCTTGATGGGAAATCGG - Intronic
1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG + Intergenic
1120622837 14:86786920-86786942 ATATATGTATAAAAGGAAATAGG + Intergenic
1122334164 14:100957381-100957403 ACAAATACATAAAGGTAAATAGG + Intergenic
1124037842 15:26072767-26072789 ATATAAGGATAATGGGAAATAGG - Intergenic
1124461846 15:29899388-29899410 ACATATGATTAAAGGGAAAATGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124508311 15:30298225-30298247 ACAATTGCATCATGGGGAATGGG - Intergenic
1124735245 15:32240431-32240453 ACAATTGCATCATGGGGAATGGG + Intergenic
1124899825 15:33811653-33811675 ACGTTCACATAATGGGAAATGGG - Intronic
1125363128 15:38885823-38885845 ACATATGCCTTATGGGAGGTAGG - Intergenic
1126585402 15:50281001-50281023 AAATATGCAGTATGGAAAATAGG - Intronic
1131291527 15:91111020-91111042 CCTTATCCATCATGGGAAATAGG - Intronic
1136238393 16:28929155-28929177 ACACATGCATAATTTGAGATTGG + Intronic
1136774712 16:32865697-32865719 ACATGGGCTTAATAGGAAATGGG - Intergenic
1136895902 16:33995815-33995837 ACATGGGCTTAATAGGAAATGGG + Intergenic
1141332592 16:83125662-83125684 TCATATGCAAAAGAGGAAATTGG + Intronic
1141692825 16:85606268-85606290 AAATATGAAAAATGGGAACTAGG + Intergenic
1203077139 16_KI270728v1_random:1127833-1127855 ACATGGGCTTAATAGGAAATGGG - Intergenic
1142576361 17:911062-911084 ACATATGCACTGTGGGAACTTGG - Exonic
1144726264 17:17504175-17504197 CCATATGCAGAGTGGGAAGTTGG + Intergenic
1149389834 17:56177373-56177395 ACATATGCATCATGGAAAATGGG - Intronic
1149766149 17:59280382-59280404 ACATATGCAGAGTGAAAAATTGG + Intergenic
1151039455 17:70841648-70841670 ACATATGCATAATGGGAGAATGG + Intergenic
1152219365 17:79053557-79053579 CCATCTGCATAATGAGAAATGGG - Intergenic
1155192427 18:23442020-23442042 AAATAGGCAGAATGTGAAATTGG + Intergenic
1156344264 18:36241647-36241669 ACAGATGGGTAATGTGAAATTGG - Intronic
1156834169 18:41532392-41532414 ACATATGCTTAATTTAAAATAGG - Intergenic
1157327855 18:46681706-46681728 ACATATGAAAAAATGGAAATGGG + Intronic
1158125651 18:54097169-54097191 ACTAATGCAGAATGGGACATAGG - Intergenic
1158872017 18:61697348-61697370 ACATCTGGAAGATGGGAAATAGG - Intergenic
1166358372 19:42240907-42240929 CCATTTGAATAATGGGAATTGGG - Intronic
925981119 2:9178395-9178417 GCCTCTGCATAATGGGAACTTGG - Intergenic
926240424 2:11080969-11080991 ACATATCTGTAATGGGAAAGGGG + Intergenic
926505207 2:13705661-13705683 ACATATGAATAAAAAGAAATTGG - Intergenic
926622928 2:15063531-15063553 ACATATGAATTTTGGGAAAGGGG - Intergenic
928739548 2:34334034-34334056 ATAAATGCATGATGGGGAATGGG - Intergenic
929072259 2:38044498-38044520 ACATATGCATAATGGGAAATGGG - Intronic
929674240 2:43909026-43909048 ACTGATACAGAATGGGAAATGGG + Intronic
929816768 2:45238665-45238687 ACATATGTATTCTGGGGAATGGG + Intergenic
932003444 2:67905605-67905627 AAACAGGCAGAATGGGAAATAGG + Intergenic
935146204 2:100397368-100397390 ACAGATGCTTAGTGTGAAATGGG + Intronic
938789179 2:134661708-134661730 ACATTTGCATAATGTGTAAATGG - Intronic
939722380 2:145669927-145669949 TCATATGCATAATAGAGAATTGG - Intergenic
939772140 2:146334631-146334653 ACATATGCATAATGTAGAACTGG - Intergenic
941063984 2:160879984-160880006 AGATATTAATAATGGGAAACTGG - Intergenic
941756521 2:169192402-169192424 ACACAAGCACAATGTGAAATAGG + Intronic
943823582 2:192359582-192359604 ACATGAGCATATTTGGAAATGGG - Intergenic
945532117 2:210968901-210968923 AAATATGCATAATTAGAAAATGG + Intergenic
945689791 2:213019494-213019516 TAACATGCCTAATGGGAAATTGG - Intronic
947155660 2:227160566-227160588 ACATATTCATCACGGGACATGGG - Intronic
947927732 2:233936370-233936392 ACAGAGGCATAACAGGAAATTGG - Intronic
948597434 2:239089184-239089206 ACAGATACGTAATTGGAAATGGG - Intronic
1170685513 20:18566311-18566333 ATATATGCATAAAGCGAAAATGG - Intergenic
1172726583 20:37048214-37048236 ACACAGGCAGAATGGGAAGTGGG + Intronic
1174943188 20:54955407-54955429 AGAGATACATAATGAGAAATGGG + Intergenic
1177284322 21:19029096-19029118 AAATATACATAATGTGAGATAGG + Intergenic
1177547232 21:22574972-22574994 AAATAAGCATTATGGGAAATGGG + Intergenic
1180822360 22:18839173-18839195 TCGTCTGGATAATGGGAAATGGG + Intergenic
1180948243 22:19708512-19708534 ACACATGCTTGATGGGAAATGGG + Intergenic
1181019052 22:20088752-20088774 AAATATACATAAGGGGAAAAAGG - Intronic
1181190611 22:21136873-21136895 TCGTCTGGATAATGGGAAATGGG - Intergenic
1181208594 22:21273634-21273656 TCGTCTGGATAATGGGAAATGGG + Intergenic
1182056220 22:27357266-27357288 ACATAACCATATTGGGGAATAGG - Intergenic
1183015030 22:34979177-34979199 TCATGTCCATAATGGGAAAAGGG + Intergenic
1184023229 22:41834643-41834665 ACAAAAGCAAAATGGGAAAATGG - Intronic
1203218340 22_KI270731v1_random:21778-21800 TCGTCTGGATAATGGGAAATGGG - Intergenic
1203272495 22_KI270734v1_random:65058-65080 TCGTCTGGATAATGGGAAATGGG + Intergenic
949184417 3:1172930-1172952 ACATGTGCATTATGTGAAAATGG - Intronic
949733819 3:7146919-7146941 ACTTCTGCCTAATGGGTAATAGG + Intronic
949903522 3:8839213-8839235 ACATCTGCAGAATGGGGATTAGG + Intronic
951695495 3:25441756-25441778 ACATATGCAAAAGGAGAAAAGGG - Intronic
952641618 3:35603359-35603381 ATTTATGCATGATGGGAAAGAGG + Intergenic
953432132 3:42848662-42848684 ACAAAAGCATGATGAGAAATAGG + Intronic
954778042 3:53037410-53037432 CCATATGCAAATTGGGAAACAGG - Intronic
956897306 3:73675867-73675889 GCATATGCAAAATGAGACATGGG - Intergenic
957836919 3:85606474-85606496 ACATATGCATATTAGAATATTGG + Intronic
958825356 3:99023173-99023195 ACAAATGCAGAAAGGTAAATAGG + Intergenic
959055712 3:101565799-101565821 AAATATTTACAATGGGAAATTGG + Exonic
959802652 3:110513178-110513200 AAATAAGCATCATGGCAAATGGG - Intergenic
960403809 3:117235531-117235553 AAGTATGCATAATGGGCAATTGG + Intergenic
960797251 3:121500602-121500624 ACATATGCATAATGAGTACCAGG + Intronic
961904637 3:130250486-130250508 CCATATGCTCAATGTGAAATTGG + Intergenic
964930429 3:162014506-162014528 ACATATGCCTTGAGGGAAATAGG - Intergenic
966647251 3:182260462-182260484 ACAGATGGATAATGGGAACATGG + Intergenic
967167995 3:186801319-186801341 ACTTTTTCATAATCGGAAATAGG + Intronic
967613743 3:191539884-191539906 ACATATGGGTCATGGTAAATAGG - Intergenic
968341484 3:197959611-197959633 AACTATACAAAATGGGAAATTGG - Exonic
968790619 4:2658717-2658739 ACACATGCAGAATGGGGAAAGGG - Intronic
970874050 4:20849093-20849115 AAACATGCATAAAGGGAAAAGGG - Intronic
971604267 4:28637400-28637422 ACATGTTCATCATGGGAACTGGG + Intergenic
971991838 4:33908537-33908559 ACATGGGCATTATGGGAATTAGG + Intergenic
972009832 4:34163981-34164003 TAATATGCATCATGGAAAATTGG - Intergenic
972155114 4:36151159-36151181 ACATATACTTTATGTGAAATAGG - Intronic
974351115 4:60747600-60747622 AAATATGCTTTATGGGAAGTAGG + Intergenic
974543693 4:63272702-63272724 ACAGATGTCTAATTGGAAATGGG + Intergenic
975506110 4:75139996-75140018 ACATTGGCATATGGGGAAATTGG - Intergenic
977803683 4:101270638-101270660 ACATCTGCATATTGGCAAAAAGG + Intronic
979892148 4:126111647-126111669 ACATATGTATAATGTCAAGTAGG + Intergenic
981752927 4:148109815-148109837 ACATATGTTTAATAGGAAAAGGG + Intronic
981756783 4:148148388-148148410 CCAAATGCAGAATGGAAAATGGG - Intronic
982743253 4:159080048-159080070 AAATAATAATAATGGGAAATGGG + Intergenic
982965116 4:161897233-161897255 ACATATTTATAATAGGTAATTGG + Intronic
983468001 4:168119307-168119329 ACATCCACATAATTGGAAATAGG + Intronic
983609421 4:169626231-169626253 ACAGATGCATAGGGGGAGATAGG + Intronic
986891734 5:12317420-12317442 ACATAAATGTAATGGGAAATTGG - Intergenic
986949792 5:13069577-13069599 ACAGATGTATATTTGGAAATGGG - Intergenic
988131883 5:27116983-27117005 ACATATGCATGTTGGGAAATGGG - Intronic
988182885 5:27820268-27820290 ACATATGCAGAGTGGAAAAATGG + Intergenic
988206941 5:28150027-28150049 ACATATCCCTAATGGATAATGGG - Intergenic
989276036 5:39589921-39589943 AAATAAGCATAAAGGGAAGTGGG + Intergenic
989426891 5:41305909-41305931 AAATAAGTATAATTGGAAATAGG - Intergenic
989825055 5:45844058-45844080 ACACAAATATAATGGGAAATGGG + Intergenic
992596138 5:78349105-78349127 AAATATGAACAATGGGAATTTGG - Intergenic
993027976 5:82667743-82667765 AAGTATACATAATGAGAAATTGG + Intergenic
993199907 5:84802332-84802354 GCATATACATAATGAGATATTGG + Intergenic
993307394 5:86289672-86289694 AGAAATGCAAAATGGGAAAGGGG - Intergenic
994492550 5:100464794-100464816 ACACATGGATTATGGCAAATTGG - Intergenic
994599458 5:101884193-101884215 ACATTTAAATCATGGGAAATAGG - Intergenic
995101432 5:108311659-108311681 GCTTATGCAGAATGGCAAATGGG - Intronic
995221335 5:109651993-109652015 GCAAATTCATAATGAGAAATTGG - Intergenic
995570938 5:113481171-113481193 ACATATATAAAAAGGGAAATAGG - Intronic
995956518 5:117783265-117783287 AAACATACATCATGGGAAATGGG - Intergenic
996175313 5:120349225-120349247 ACATATGCATAATGTGGTTTTGG + Intergenic
998363250 5:141609947-141609969 ACATATGCATGATAGAAAAGAGG + Intronic
998731042 5:145077446-145077468 ACAAATGAATAATGTGAAAATGG + Intergenic
998942575 5:147300618-147300640 ACATTGGCATAATGGCAAAAAGG - Intronic
1000995138 5:167950854-167950876 ACTGATGCATAATGTAAAATAGG + Intronic
1004947707 6:20634411-20634433 ACATATGCATAATTGAAAACTGG - Intronic
1005816773 6:29559510-29559532 ACATTTGCAGAATGGGAAGAGGG - Intronic
1008883339 6:56404903-56404925 ACATATGCATTATCTGCAATTGG - Intergenic
1011716439 6:90110175-90110197 ACAGATACATAGTTGGAAATGGG + Intronic
1012311760 6:97734316-97734338 TCATATGAATACTGTGAAATAGG + Intergenic
1012533245 6:100263939-100263961 GGATATGGATAATGGAAAATTGG + Intergenic
1013657162 6:112257830-112257852 ACATATAGATAATGTTAAATGGG - Intergenic
1014664273 6:124217057-124217079 ACATAGCCATACTGGGAAAATGG + Intronic
1014714183 6:124844642-124844664 CCATATGCATATTGGTAATTTGG + Intergenic
1015455843 6:133425195-133425217 TCATATGCAAAATGTTAAATAGG + Intronic
1015931029 6:138359973-138359995 ACACATGCATGATGGGGAAAGGG + Intergenic
1017864690 6:158432756-158432778 ACATATTCATAATAGAAAGTTGG - Intronic
1019241521 6:170666731-170666753 ATAAGTGCATAATGGAAAATTGG + Intergenic
1021583443 7:22181812-22181834 AAATGAGGATAATGGGAAATGGG + Intronic
1021920971 7:25484387-25484409 ACAGGTGCAGAATGGGAAGTGGG + Intergenic
1021992915 7:26154012-26154034 TCTTATGCAAAATGGGAATTGGG + Intronic
1022615478 7:31925915-31925937 ACATATGCATACATGGAAATCGG - Intronic
1024757730 7:52555924-52555946 AAAGATGCAGAATGGAAAATAGG + Intergenic
1026174195 7:67981617-67981639 ACATATGAATTTTGGGAATTCGG + Intergenic
1026682908 7:72482692-72482714 AAATATGAATAATGGAATATTGG - Intergenic
1027716340 7:81676029-81676051 ACATATCTGTAATGGCAAATAGG + Intergenic
1029262742 7:99314431-99314453 AGAAATGCATTATGGGAATTAGG + Intergenic
1033643367 7:143283575-143283597 ACATATGAATAGAAGGAAATTGG - Intronic
1038520292 8:28226609-28226631 ACATATTCTTAAAGGGACATTGG + Intergenic
1039195322 8:35024607-35024629 ACTTTTGAATAATGGGAAATGGG + Intergenic
1040922966 8:52644255-52644277 ACATACACATCATGGAAAATTGG + Intronic
1041789824 8:61682310-61682332 ACAAACCCATAATGGGAAATTGG + Intronic
1042890551 8:73604971-73604993 ACAGATGCATTATTTGAAATAGG + Intronic
1043773120 8:84229759-84229781 TCATATGTAAAATGAGAAATTGG - Intronic
1043883110 8:85567376-85567398 ACATATATATAATGGGATATAGG - Intergenic
1044014084 8:87029460-87029482 ACATAGACACATTGGGAAATGGG + Intronic
1044861616 8:96529544-96529566 ATATTTCCATAATGTGAAATGGG - Intronic
1050622322 9:7467353-7467375 ACATCTGCAATTTGGGAAATGGG - Intergenic
1051025032 9:12598525-12598547 TCATATGGATAATCTGAAATTGG + Intergenic
1051483600 9:17585225-17585247 ACAAATGAATAATGAGAATTAGG + Intronic
1058358958 9:104119434-104119456 ATAGTTGCATAATGTGAAATCGG + Intronic
1203601713 Un_KI270748v1:15965-15987 ATAAGTGCATAATGGAAAATTGG + Intergenic
1186911071 X:14166704-14166726 TAGTATGCTTAATGGGAAATAGG - Intergenic
1188086010 X:25902360-25902382 AGATATGCATAAATGGAAAGAGG - Intergenic
1191090356 X:56614493-56614515 AGATATCCATATTGGAAAATTGG + Intergenic
1193067444 X:77275016-77275038 ACATCTGCCTCATGGGAAAATGG + Intergenic
1193350423 X:80457319-80457341 ACAAGTGAAGAATGGGAAATGGG + Intergenic
1193420510 X:81277698-81277720 ACATCTTCTTACTGGGAAATAGG + Intronic
1195208044 X:102624233-102624255 ACTTATGCATAATGGTCAGTAGG + Intergenic
1195952409 X:110289196-110289218 ACATGTGGATAATGGGGAGTTGG - Intronic
1196317772 X:114249350-114249372 GCATATGTATAATGGCTAATTGG - Intergenic
1196810707 X:119627003-119627025 ACATTTGCATAAAGAGTAATTGG + Intronic
1197675720 X:129327738-129327760 ACATATCCGTAAAGGGATATGGG + Intergenic
1198985170 X:142442867-142442889 ACATATTTACAATAGGAAATTGG + Intergenic
1200489908 Y:3811991-3812013 TCATATGCTTAAGGGGAAAAAGG + Intergenic
1200830363 Y:7682973-7682995 ACATATGCCCAATGGAAAAATGG + Intergenic
1201648003 Y:16256879-16256901 AATTAACCATAATGGGAAATTGG - Intergenic
1201654807 Y:16328422-16328444 AATTAACCATAATGGGAAATTGG + Intergenic