ID: 929076529

View in Genome Browser
Species Human (GRCh38)
Location 2:38083379-38083401
Sequence GGCTTGCTTGGTTTTAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 6, 2: 325, 3: 283, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929076526_929076529 -6 Left 929076526 2:38083362-38083384 CCTGAACTAACTTGTAAGGCTTG 0: 256
1: 183
2: 209
3: 141
4: 134
Right 929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG 0: 1
1: 6
2: 325
3: 283
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929076529 Original CRISPR GGCTTGCTTGGTTTTAGGAC AGG Intronic
900722398 1:4185853-4185875 GCCTGGTCTGGTTTTAGGACAGG + Intergenic
900840944 1:5047947-5047969 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
900847630 1:5116222-5116244 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
901670363 1:10852434-10852456 GGCTTGCTGTGTTTTAAGAGAGG + Intergenic
902032766 1:13434732-13434754 AGCTTGATTGGTTTTGGGAGGGG - Intergenic
902216294 1:14936420-14936442 GACTTTCTTGGTTCTAGCACTGG + Intronic
903147171 1:21381860-21381882 GGCTTGCTGGGTTCAAGGAGTGG - Intergenic
903395868 1:23001559-23001581 GACTTGTCTGGTTTTTGGACAGG + Intergenic
904711781 1:32435438-32435460 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
904996336 1:34634568-34634590 GCCTTGTCTGGTTTTTGGACAGG + Intergenic
906081061 1:43088602-43088624 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
906744368 1:48211593-48211615 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
907292773 1:53427392-53427414 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
907503426 1:54900479-54900501 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
907521412 1:55025694-55025716 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
908461560 1:64352578-64352600 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
908591802 1:65644489-65644511 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
908852562 1:68389363-68389385 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
908965390 1:69755844-69755866 GGCTTGATAGGTTTTAGTGCAGG - Intronic
909035619 1:70591395-70591417 GCCTTGTCTGGTTTCAGGACAGG - Intergenic
909222518 1:72982452-72982474 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
909223509 1:72990426-72990448 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
909408515 1:75320794-75320816 AGCTTGCTTGGTAATTGGACAGG - Intronic
909776537 1:79491178-79491200 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
909792844 1:79698974-79698996 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
909978300 1:82070132-82070154 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
910002587 1:82357468-82357490 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
910049541 1:82958440-82958462 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
911071339 1:93834237-93834259 GACTTGTCTGGTTTTTGGACAGG - Intronic
911147832 1:94569476-94569498 GGCTTGTCCGGTTTTTGGACAGG + Intergenic
911510480 1:98803864-98803886 GGCTTGTCTGGTTTTAGAACAGG + Intergenic
911570537 1:99512719-99512741 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
911759625 1:101600650-101600672 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
912733374 1:112129150-112129172 CTCTTTCTTGGTTTTAGGAGGGG + Intergenic
912815105 1:112822763-112822785 GGCTTGTCCAGTTTTAGGACAGG + Intergenic
913245275 1:116865187-116865209 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
915139684 1:153759551-153759573 AGCTGGCTTTGTTTTATGACTGG + Exonic
916329006 1:163594112-163594134 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
918347268 1:183616747-183616769 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
918567518 1:185950910-185950932 GGCTTGTCTGGTTTTAGGACAGG + Intronic
918650107 1:186951987-186952009 GACTTGCTTGCTTCCAGGACAGG - Intronic
918714252 1:187768120-187768142 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
920425552 1:205872310-205872332 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
920427209 1:205887933-205887955 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
920829555 1:209452016-209452038 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
921212568 1:212912600-212912622 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
921459626 1:215412557-215412579 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
921495395 1:215834515-215834537 TGTTTGCTTAGTTTTAGGAAGGG + Intronic
921509407 1:216011096-216011118 GGCTTGTCTGGTTTTAGGACAGG - Intronic
921520289 1:216148643-216148665 GGCTTGTCTGGTTTTAGGACAGG - Intronic
921732825 1:218596403-218596425 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
922046557 1:221951024-221951046 GACTTGTCTGGTTTTTGGACAGG - Intergenic
922048556 1:221969040-221969062 GGTTTATCTGGTTTTAGGACAGG - Intergenic
922049387 1:221975717-221975739 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
922153915 1:223027021-223027043 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
922934970 1:229415470-229415492 GCCTTGTCTAGTTTTAGGACAGG - Intergenic
923214050 1:231832821-231832843 GGCTTGTCTGGTTCTAGGACAGG + Intronic
923244904 1:232121278-232121300 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
923257192 1:232232246-232232268 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
923408475 1:233686046-233686068 ACCTTGTCTGGTTTTAGGACAGG + Intergenic
923689103 1:236175836-236175858 GGCTTGCTTGGTTAGGTGACTGG + Intronic
923770590 1:236934877-236934899 GGCTTGTCTAGTTTTAGGACAGG + Intergenic
923962928 1:239104461-239104483 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
924180804 1:241437066-241437088 GGTTTGTCTGGTTTCAGGACAGG - Intergenic
924896028 1:248338841-248338863 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1062930904 10:1351828-1351850 GCCTTGTCTGGTTTTAGGACAGG - Intronic
1063106267 10:2995591-2995613 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
1063363306 10:5474206-5474228 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1063509444 10:6632210-6632232 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1063527530 10:6799710-6799732 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1064886850 10:20121777-20121799 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1065437776 10:25719546-25719568 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
1065442972 10:25771365-25771387 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1066002626 10:31118622-31118644 GGCTTGCTTGCTTTGTGGACTGG - Intergenic
1066437065 10:35405129-35405151 GCCTTGTCTGGTTTTTGGACAGG + Intronic
1067360553 10:45574300-45574322 GACTTGTCTGGTTTTTGGACAGG - Intronic
1068058197 10:52036380-52036402 GGCTCGTCCGGTTTTAGGACAGG + Intronic
1068179505 10:53501647-53501669 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1068231123 10:54169851-54169873 GGCTTATCTGGTTTTAGGACAGG - Intronic
1068360920 10:55974292-55974314 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1068592189 10:58863630-58863652 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1068908820 10:62356946-62356968 TTCTTTCTTGGTTTTAGGAGGGG - Intergenic
1069145667 10:64889831-64889853 CTCTTTCTTGGTTATAGGACAGG - Intergenic
1070475077 10:76821673-76821695 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
1071187384 10:83060243-83060265 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1071897590 10:90083652-90083674 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1071961265 10:90810521-90810543 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1072580417 10:96735312-96735334 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1073014171 10:100384855-100384877 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1073709337 10:106020229-106020251 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1073737492 10:106366449-106366471 GGCATGATTGGGTTGAGGACAGG + Intergenic
1074019174 10:109565455-109565477 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1074645500 10:115446879-115446901 GGTTTGCTTGGATTTATGAAAGG + Intronic
1074740930 10:116483746-116483768 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
1075013977 10:118896638-118896660 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
1075248850 10:120847938-120847960 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
1075986817 10:126795192-126795214 GACATGGTTGGTTTTAGGGCTGG + Intergenic
1077589749 11:3482295-3482317 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1077678922 11:4221872-4221894 GACTTGTCTGGTTCTAGGACAGG + Intergenic
1077688360 11:4318513-4318535 GACTTGTCTGGTTCTAGGACAGG + Intergenic
1077766235 11:5162897-5162919 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1077850651 11:6072449-6072471 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1077883503 11:6368903-6368925 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1078045983 11:7914777-7914799 GGCGTGTCTGGTTTTAGGACAGG + Intergenic
1079230660 11:18646129-18646151 GGCTTGTCCGGTTTTTGGACAGG - Intergenic
1079447612 11:20570887-20570909 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1079638909 11:22779836-22779858 AGGTTGGTTGGTTGTAGGACAGG - Intronic
1079672418 11:23186551-23186573 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1079726937 11:23889803-23889825 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1079898841 11:26155622-26155644 GCTTCGCTTGGATTTAGGACTGG - Intergenic
1080027762 11:27631696-27631718 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1082197621 11:49324051-49324073 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1083534554 11:63456004-63456026 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1084232449 11:67762762-67762784 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1084245465 11:67854069-67854091 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1084354349 11:68627236-68627258 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1084355701 11:68636801-68636823 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1084613135 11:70216930-70216952 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1084827217 11:71740509-71740531 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1085934420 11:81124885-81124907 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1085988159 11:81809307-81809329 CGCTTGTCTGGTTCTAGGACAGG - Intergenic
1086005168 11:82028320-82028342 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
1086133297 11:83422200-83422222 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1086134687 11:83434221-83434243 GCCTTGTCTGGTTTTACGACAGG + Intergenic
1086163233 11:83746922-83746944 GTACTGCTTGGTTTTAGGGCAGG - Intronic
1086550360 11:88046281-88046303 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1086658206 11:89384076-89384098 GACTTGTCTGGTTTTTGGACAGG - Intronic
1087099236 11:94348814-94348836 GCCTTGTCTGGTTTCAGGACAGG - Intergenic
1087099784 11:94352744-94352766 GCCTTGTCTGGTTCTAGGACAGG - Intergenic
1087127960 11:94644702-94644724 GGTTTGTCTGGTTTTAGGACAGG - Intergenic
1087197059 11:95312612-95312634 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1087314828 11:96591023-96591045 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1088000625 11:104876089-104876111 GACTTGGTGGGTTTTAGGATGGG + Intergenic
1089349235 11:117812365-117812387 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1089470913 11:118719623-118719645 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1089684478 11:120138059-120138081 GGCTTGCTGGGGTTCAGGATAGG + Exonic
1089866904 11:121640541-121640563 GCTTTGTCTGGTTTTAGGACAGG + Intergenic
1089987818 11:122830211-122830233 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1090107451 11:123868206-123868228 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1090526665 11:127545346-127545368 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1090546353 11:127771693-127771715 GGCTTGTCTGGCTTTAGGACAGG + Intergenic
1090850445 11:130566977-130566999 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1090871812 11:130756130-130756152 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1090926790 11:131257107-131257129 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1091183828 11:133629888-133629910 AGCTTCTCTGGTTTTAGGACAGG - Intergenic
1091886671 12:4021639-4021661 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1092416044 12:8291201-8291223 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1092592607 12:9965686-9965708 GCCTTGTCTGGTTTTAGGACAGG + Intronic
1092626601 12:10335541-10335563 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1092723583 12:11464796-11464818 GGCTTGTCTGGTTTTAGGATAGG + Intronic
1092739181 12:11612322-11612344 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1092789852 12:12061482-12061504 GGCTTGTCTTGTTCTAGGACAGG - Intronic
1092924702 12:13262581-13262603 GGCTTATCTGGTTTTAGGACAGG + Intergenic
1092977710 12:13761642-13761664 GGTTTGATTGCTTTTAGGAAAGG - Intronic
1093071014 12:14707486-14707508 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1093267893 12:17024494-17024516 GGCTTGTCTGATTTTAGGACAGG + Intergenic
1093302447 12:17473045-17473067 GACTTGTCCGGTTTTAGGACAGG - Intergenic
1093321838 12:17722887-17722909 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1093358579 12:18198053-18198075 GACTTGTCTGGTTTTTGGACAGG - Intronic
1093584373 12:20819626-20819648 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1093812687 12:23508636-23508658 GCCTTGTCTGGTTTTAGAACAGG + Intergenic
1093951219 12:25166242-25166264 ACCTTGTCTGGTTTTAGGACAGG - Intronic
1094315902 12:29137618-29137640 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1094825890 12:34268729-34268751 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1095637797 12:44452892-44452914 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1095998876 12:48112748-48112770 GGCTTGTCTGGTTTTTGGATAGG + Intronic
1097052166 12:56230169-56230191 TGCTTGCCTGATTTTAGGCCAGG + Intronic
1097398733 12:59104929-59104951 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1097416904 12:59325833-59325855 GGTTTGTCTGGTTTTAGGACAGG + Intergenic
1097542045 12:60954601-60954623 GGCTTGTCTGGTTCTAGGCCAGG + Intergenic
1098173488 12:67769261-67769283 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1098402402 12:70088500-70088522 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1098629212 12:72706449-72706471 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1098629880 12:72711514-72711536 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1098653680 12:73004630-73004652 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1098787383 12:74776641-74776663 TGCTTGCTTGCTTTTGAGACAGG - Intergenic
1099188868 12:79542960-79542982 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1099291952 12:80785696-80785718 GGTTTGTCTGGTTTTAGGACAGG + Intergenic
1099762737 12:86941898-86941920 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1099835946 12:87910008-87910030 GCCTTGTCTAGTTTTAGGACAGG + Intergenic
1100181686 12:92093075-92093097 GGTTTGCTTGTTTTTGAGACAGG + Intronic
1100561508 12:95752259-95752281 GGCTTGTCTGGTTCTAGGACAGG - Intronic
1100940498 12:99718594-99718616 GGCTTGTCTGGTTCTAGGACAGG - Intronic
1101278248 12:103225291-103225313 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1102116597 12:110407908-110407930 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1104300871 12:127563786-127563808 GACTTGCATGGTTATAGGAGAGG + Intergenic
1106222605 13:27759019-27759041 GACTTGCTTGATTTTAGGTTGGG - Intergenic
1106943594 13:34801733-34801755 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1107075736 13:36319540-36319562 GGCTTGTCTGGTTTCAGGACAGG - Intronic
1107202052 13:37733265-37733287 GGCTCGCTGTGTTTTGGGACTGG - Intronic
1107219623 13:37967013-37967035 GGAATGCCTGGTTCTAGGACAGG - Intergenic
1107682989 13:42870031-42870053 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
1108202844 13:48059491-48059513 GGCTTGTCTGGTTCTAGGACAGG - Intronic
1108513145 13:51172963-51172985 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1108803721 13:54130302-54130324 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1108814276 13:54269956-54269978 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1108913270 13:55580857-55580879 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1108919402 13:55657587-55657609 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1108947585 13:56043404-56043426 GGCTTGTCCGGTTTTAGGACAGG - Intergenic
1108952800 13:56115029-56115051 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1109343726 13:61091459-61091481 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1109353061 13:61207899-61207921 GGCTTGTCTGGTCCTAGGACAGG - Intergenic
1109499443 13:63216210-63216232 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1109709512 13:66143946-66143968 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1109716592 13:66228997-66229019 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1110650343 13:77935941-77935963 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1110765628 13:79277228-79277250 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1110845489 13:80186767-80186789 GCCTTGTCTGGTTTCAGGACAGG - Intergenic
1111125889 13:83910896-83910918 GCCTTGCCTGGTTTTAGGACAGG + Intergenic
1111302191 13:86361499-86361521 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1111361956 13:87189035-87189057 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1111458691 13:88515445-88515467 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1111630587 13:90842538-90842560 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1111631552 13:90851203-90851225 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1112236976 13:97645411-97645433 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1112889182 13:104210722-104210744 GCCTTGTGTGGTTTTAGGACAGG + Intergenic
1113324480 13:109268438-109268460 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1115904958 14:38193891-38193913 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1116179828 14:41519043-41519065 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1116490430 14:45497997-45498019 GGCTTGTTTGGTTCTAGGACAGG + Intergenic
1116534628 14:46015038-46015060 GACTTGTTGGGTTTTTGGACAGG + Intergenic
1116573598 14:46547011-46547033 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1116613664 14:47107281-47107303 GACTTGTCTGGTTTTAGGACAGG - Intronic
1116702256 14:48257995-48258017 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1117801334 14:59447175-59447197 GGCTTGTCTGGTTCTAGGACAGG - Intronic
1117957765 14:61136036-61136058 GGCTTGTCTGGTTCCAGGACAGG + Intergenic
1119022570 14:71127420-71127442 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1119061513 14:71479731-71479753 GCTTTGCTTTGTTTTAAGACAGG + Intronic
1119248187 14:73130939-73130961 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1119317351 14:73706594-73706616 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1119560125 14:75583290-75583312 GGCTTGTCCGGTTTTTGGACAGG + Intronic
1120251250 14:82063699-82063721 GGCTTGTCTGGTTCTAGGACAGG + Intergenic
1120437909 14:84502829-84502851 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
1120467375 14:84876991-84877013 CTTTTGCTTGATTTTAGGACAGG - Intergenic
1120468555 14:84893492-84893514 GACTTGATTGGTTTTAAGATGGG + Intergenic
1120618389 14:86734417-86734439 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1121703797 14:95976048-95976070 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1121980436 14:98449737-98449759 GGCTTGTCTGCTTTTAGGACAGG + Intergenic
1122041146 14:98988295-98988317 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1122381181 14:101308328-101308350 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
1122945889 14:105008933-105008955 GGCATTCTTGGTTTTTTGACAGG - Intronic
1123882348 15:24688195-24688217 GGCTTGTCTGGTTCTAGGACAGG + Intergenic
1124916475 15:33979477-33979499 TGCTTGCTTGTTTTTGAGACAGG - Intronic
1125045920 15:35241870-35241892 GGCTTGTCTGGTTTTAAGACAGG - Intronic
1125131367 15:36288253-36288275 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1125213067 15:37238828-37238850 GCCTTGTATGGTTTTAGGACAGG + Intergenic
1125278609 15:38020454-38020476 GGCTTGCTTCTTTTCAGGACTGG - Intergenic
1126530002 15:49701753-49701775 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1126843897 15:52741677-52741699 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1126912262 15:53429453-53429475 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1127356855 15:58208841-58208863 GCCTTTCTTGGTTGTAGGAGGGG - Intronic
1128141628 15:65305396-65305418 GGCTGGCTGGGTCTTAGGGCAGG + Intergenic
1130781212 15:87042745-87042767 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1130855254 15:87834365-87834387 GGCTTGTCTGGTTTTAGGAAAGG - Intergenic
1130945798 15:88550114-88550136 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1131447894 15:92514606-92514628 GGCTTGTTTGGTTCTAGGACAGG - Intergenic
1131684327 15:94753869-94753891 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1131684853 15:94757568-94757590 GCCTTGTCTGGTTCTAGGACAGG - Intergenic
1131882362 15:96874436-96874458 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1132735157 16:1382328-1382350 GGCTCACCTGGTTTCAGGACAGG - Intronic
1133765579 16:8835642-8835664 GCCTTGTCTGGTTTTAGGACAGG + Intronic
1133869400 16:9673704-9673726 GGCTTGTCTGGTTTTAGGACGGG + Intronic
1133938322 16:10286255-10286277 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1134342027 16:13355180-13355202 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1136182633 16:28564939-28564961 GGCTTCCCTGGTTTTAAGGCTGG - Intronic
1137363575 16:47841625-47841647 GGCTTGTCTGGTTTTTGAACAGG - Intergenic
1137369243 16:47889372-47889394 TGCTTGTTTGTTTTTAAGACAGG - Intergenic
1138758946 16:59520251-59520273 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1138805102 16:60081928-60081950 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1139039088 16:62981759-62981781 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1139225767 16:65232444-65232466 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1139230439 16:65277866-65277888 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1139942905 16:70619085-70619107 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1139943578 16:70623407-70623429 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1140982837 16:80127153-80127175 AACTTGCTTGGTTTTGGGACTGG + Intergenic
1141796689 16:86279634-86279656 GCCCTGTCTGGTTTTAGGACAGG - Intergenic
1143266262 17:5640223-5640245 GTCTTGCTTGGCTTTGGCACTGG + Intergenic
1144104818 17:11974985-11975007 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1144701817 17:17345334-17345356 GGCTTGTTTGGTTTTGGGGAGGG - Intronic
1145080516 17:19891078-19891100 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1146598055 17:34186375-34186397 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1149736403 17:58997968-58997990 GACCTGTTTGCTTTTAGGACAGG - Intronic
1151622635 17:75255669-75255691 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1151839599 17:76608569-76608591 GGCTTGTCTGGTTTTAGGATAGG + Intergenic
1153777227 18:8464968-8464990 GGCCTTCCTGGTTTTAGCACTGG + Intergenic
1155173973 18:23287151-23287173 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1155623157 18:27804768-27804790 TGTTTGTTTGTTTTTAGGACAGG + Intergenic
1155696872 18:28695727-28695749 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1155892560 18:31286849-31286871 GGCTTGTCTGGTTTTTGCACAGG + Intergenic
1155908881 18:31486337-31486359 GGCTTGCAGGCTTTTAGGGCAGG - Intergenic
1156251782 18:35358929-35358951 GGCTTGTTTGGTTCTAGGACAGG + Intergenic
1156302402 18:35847019-35847041 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1156923903 18:42555104-42555126 GTCTTTTCTGGTTTTAGGACAGG + Intergenic
1156938680 18:42739747-42739769 GCCTTGGCTGGTTTTAGGACAGG - Intergenic
1156958329 18:42993974-42993996 GGCTTGTTTGGTTTTTGGACAGG - Intronic
1157906243 18:51572648-51572670 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1158336526 18:56418691-56418713 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1158394499 18:57069240-57069262 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1159566211 18:70053509-70053531 GATTTACTTGGTTTTAGGTCTGG - Intronic
1159835199 18:73327737-73327759 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1163907331 19:20158634-20158656 GTCTTATCTGGTTTTAGGACAGG - Intergenic
1164153125 19:22571341-22571363 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1164459089 19:28432551-28432573 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
1165510175 19:36262103-36262125 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1165835507 19:38752707-38752729 GTCTTGTCTGGTTTTAGGACAGG - Intronic
1166498789 19:43326120-43326142 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1166905638 19:46106667-46106689 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1166926989 19:46275940-46275962 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1167046467 19:47052432-47052454 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1167099609 19:47396139-47396161 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1167566815 19:50261924-50261946 GGCTTTCTCTGTTTTAGCACTGG - Intronic
1167902297 19:52630868-52630890 GTCTTATCTGGTTTTAGGACAGG - Intronic
1168051786 19:53834699-53834721 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1168211977 19:54897511-54897533 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1168315884 19:55484635-55484657 GCCTTTTTTGGTTTCAGGACAGG - Intergenic
925828672 2:7875288-7875310 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
926407913 2:12572853-12572875 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
926413740 2:12629599-12629621 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
926463940 2:13166606-13166628 GCTTTGTCTGGTTTTAGGACAGG + Intergenic
926815395 2:16794550-16794572 GACTTGTCTGGTTTTAGGACAGG + Intergenic
927348629 2:22078718-22078740 TGCTTGCTTGGTTCTGGGATTGG - Intergenic
928770670 2:34699705-34699727 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
928770940 2:34701441-34701463 GGCTTGTCTGGCTTTAGGACAGG - Intergenic
928779563 2:34803578-34803600 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
928827514 2:35439713-35439735 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
928857318 2:35816176-35816198 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
929004694 2:37383612-37383634 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG + Intronic
929789515 2:45012959-45012981 GGCTTCCCTGGTTTTGGGATGGG + Intergenic
929792912 2:45037049-45037071 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
929932564 2:46270329-46270351 AACTTGCTTCCTTTTAGGACAGG + Intergenic
930487213 2:52024721-52024743 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
930955247 2:57196056-57196078 GCCTTGTCTGTTTTTAGGACAGG - Intergenic
930958540 2:57231985-57232007 GGCCTGTCTGGTTTTAGGACAGG - Intergenic
931026243 2:58116034-58116056 GCCTTGTCTGGTTTTAGGACAGG + Intronic
931042760 2:58316801-58316823 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
931237086 2:60420699-60420721 ACCTTGTCTGGTTTTAGGACAGG - Intergenic
931608793 2:64077794-64077816 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
931625930 2:64255630-64255652 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
931850564 2:66247023-66247045 GACTTGTCTGGTTTTAGGACAGG - Intergenic
931948404 2:67334698-67334720 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
932159301 2:69446266-69446288 GGCTTGTCCGGTTTTTGGACAGG + Intergenic
932295994 2:70623728-70623750 GACTTGTCTGGTTTTAGGACAGG - Intronic
932358669 2:71087656-71087678 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
932810861 2:74824696-74824718 GGATTGCTGGGTTAAAGGACAGG + Intergenic
932854061 2:75216386-75216408 GGCTTGTCTGGTTTTAGGACTGG + Intergenic
932973804 2:76576463-76576485 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
933013236 2:77091468-77091490 GGCTTGTCTGGTTTTAGGACTGG - Intronic
933079416 2:77968201-77968223 GGCTTGTCTGGTTTTAGGACTGG - Intergenic
933138080 2:78760993-78761015 GGCTGGTCTGGTTTTTGGACAGG - Intergenic
933163863 2:79054472-79054494 GGCTTGTCCGGTTTTAGGACAGG - Intergenic
933179619 2:79214430-79214452 GGCTCGTCTGGTTCTAGGACAGG + Intronic
933329367 2:80877080-80877102 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
933552245 2:83791519-83791541 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
933781603 2:85806228-85806250 GGCTTCCTGGGTTTTAAGTCTGG + Intergenic
933838402 2:86264573-86264595 GGGTGGCTTGGTATTAGGATGGG - Intronic
935053890 2:99548735-99548757 GGTTTGGTTGGTTTTGAGACCGG - Intronic
936665149 2:114586243-114586265 TGCTTGCTTGTTTTTGAGACAGG - Intronic
936794143 2:116186879-116186901 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
936883481 2:117281833-117281855 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
937228933 2:120385538-120385560 GTCTTGCTAGGTTTCAGGAGGGG + Intergenic
937955360 2:127418978-127419000 GGCCTGTGTGGTTTTAGGCCTGG - Intronic
939083001 2:137685554-137685576 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
939307551 2:140429234-140429256 GGCTTGTCTGGTTTTAGGACAGG - Intronic
939460594 2:142492457-142492479 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
940107496 2:150115702-150115724 GCCTTGTCTGGTTTTAGCACAGG - Intergenic
940216973 2:151311926-151311948 GGCTTGTCCGGTTTTTGGACAGG - Intergenic
940508637 2:154585847-154585869 GGTTTGTCTGGTTTTAGGACAGG + Intergenic
940530328 2:154870412-154870434 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
941340539 2:164298944-164298966 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
941353535 2:164462210-164462232 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
941410265 2:165147029-165147051 GCCTGGCTTTGTTTTATGACAGG - Exonic
941935750 2:170980254-170980276 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
942258449 2:174131483-174131505 GAATTGCTTGGTTGTAGGTCAGG + Intronic
943412782 2:187563099-187563121 GGCTTGTCTGGTTTTAGGACAGG + Intronic
943421434 2:187673097-187673119 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
943450279 2:188036305-188036327 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
943461048 2:188171817-188171839 GCCTCGTCTGGTTTTAGGACAGG + Intergenic
943865485 2:192921156-192921178 GACTTGTCTGGTTTTAGGACAGG - Intergenic
944387597 2:199182466-199182488 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
944394286 2:199250027-199250049 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
944875975 2:203964530-203964552 GGCTTGTCTGGTTTTAGGACCGG + Intergenic
945152952 2:206809466-206809488 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
945173602 2:207020344-207020366 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
945301338 2:208218849-208218871 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
945361785 2:208902334-208902356 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
945376252 2:209081169-209081191 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
945394446 2:209302313-209302335 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
945938473 2:215925473-215925495 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
946214885 2:218176628-218176650 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
946780895 2:223192449-223192471 GGCTTGTCTGGTTTTAGGACAGG + Intronic
946871616 2:224090461-224090483 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
947827995 2:233119133-233119155 GTCTTACTTGGTTTTAGCATTGG + Intronic
948390839 2:237610047-237610069 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1168739439 20:175329-175351 GCCTTGTCCGGTTTTAGGACAGG - Intergenic
1170068721 20:12342886-12342908 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1170106382 20:12756973-12756995 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1170165891 20:13360045-13360067 GGCTTGTCTGGTTTTAGCACAGG - Intergenic
1170335733 20:15268189-15268211 GATTTGCTTGGTTTGAGAACAGG + Intronic
1170820553 20:19753771-19753793 GCCTTGCCTGGTTTTAGGACAGG + Intergenic
1172932318 20:38595325-38595347 GGCTTGTGTGGTTTTTGGACAGG + Intergenic
1173119021 20:40272147-40272169 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1173640903 20:44601241-44601263 GGCCTGCTTGGGTCTAGGCCTGG + Intronic
1173688818 20:44943016-44943038 GGCATGCTGGGTTTCAGGAGCGG + Exonic
1173769271 20:45644345-45644367 GGCTTGCTTGTTTTTGAGACAGG + Intergenic
1175990117 20:62784534-62784556 GGCTTCCTTGGCTTTCGGGCAGG - Intergenic
1177100767 21:16895260-16895282 GGCTTTTCTGGTTTTAGGACAGG - Intergenic
1177102818 21:16917088-16917110 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1177840606 21:26230662-26230684 GGCTTGTCTGGTTCTAGGACAGG + Intergenic
1179015082 21:37589339-37589361 GGCTTGTCTGGTTCTAGGACAGG + Intergenic
1179387708 21:40958046-40958068 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1179650221 21:42803655-42803677 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1180980758 22:19877005-19877027 GGCTGGCTCTGTTTGAGGACAGG - Intronic
1181336658 22:22139014-22139036 CCTTTGCTTGTTTTTAGGACTGG - Intergenic
1181367490 22:22389295-22389317 GCCTTTCTTGGTTGTAGGAGGGG + Intergenic
1182732424 22:32505869-32505891 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1182998747 22:34837410-34837432 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1183500927 22:38178563-38178585 GCCTTGTTTTGTTTTAAGACAGG - Intronic
949161943 3:893281-893303 GGCTTGTCTGGTTTCAGGACAGG + Intergenic
949671304 3:6400776-6400798 GACTTGTCTGGTTCTAGGACAGG - Intergenic
949827592 3:8180107-8180129 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
950926642 3:16747413-16747435 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
951316176 3:21191811-21191833 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
951332183 3:21381178-21381200 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
951719337 3:25680973-25680995 TGCTTTCTTGGTTTTAGCTCTGG - Intergenic
952343427 3:32464031-32464053 GGCTTGTCTGGTTCGAGGACAGG + Intronic
952663318 3:35876939-35876961 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
952895070 3:38073280-38073302 GACTTGTCTGGTTTTTGGACAGG + Intronic
952895904 3:38078889-38078911 GGCTTGTCTGGTTTTAGGACAGG + Intronic
953825558 3:46248922-46248944 GGCTTGTCTGGTTTTAGGACAGG + Intronic
954161622 3:48726938-48726960 GACTTGTCTGGTTTTTGGACAGG + Intronic
954162028 3:48729683-48729705 GGGCTGGTTGGTTTGAGGACTGG + Intronic
954969124 3:54637103-54637125 GGCTTGTCCGGTTTTAGGACAGG + Intronic
955253520 3:57306779-57306801 GCCTTGTCTGGTTTTAGGACAGG - Intronic
955546607 3:60037675-60037697 GACTTACTTGGTTTTAGGCCGGG - Intronic
956135403 3:66093338-66093360 GGATTGCTTGGGTTTGGGAATGG + Intergenic
956709360 3:72026089-72026111 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
957059767 3:75472689-75472711 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
957295380 3:78326902-78326924 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
957317158 3:78585757-78585779 GGCTTGTCTGGTTTTAGATCAGG + Intergenic
957734725 3:84190415-84190437 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
958676658 3:97275594-97275616 GGCTTGTCTGGTTCTAGGACAGG + Intronic
959288204 3:104442527-104442549 GGCTTCTCTGGTTTTAGGACAGG + Intergenic
959485630 3:106925338-106925360 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
959972114 3:112420174-112420196 GGGTTGTCTGGTTTTAGGACAGG + Intergenic
960282724 3:115796113-115796135 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
960309976 3:116107931-116107953 GGCTTGTCTGGTTTTAGGACAGG + Intronic
961164612 3:124755171-124755193 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
961293637 3:125866748-125866770 GGGGTGGATGGTTTTAGGACAGG - Intergenic
961711477 3:128831807-128831829 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
961730733 3:128962797-128962819 GCCTTGTCTGGTTTTAGGACAGG - Intronic
961881191 3:130062363-130062385 GGCTTGTCTGGTTTTAGAACAGG - Intergenic
961893588 3:130149813-130149835 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
962461858 3:135621495-135621517 GACTTTCTTGGTTTTAGCACTGG - Intergenic
962660784 3:137598574-137598596 GTCTTGCCTGGTTTGAGGACAGG - Intergenic
962956722 3:140273665-140273687 CCCTTGCTGGGTTTTAGGAGAGG - Intronic
963319884 3:143800382-143800404 GACTTGTCTGGTTTTGGGACAGG - Intronic
963425365 3:145116081-145116103 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
963468754 3:145713493-145713515 GCCTTGGCTGGTTTTAGGACAGG - Intergenic
963520585 3:146356649-146356671 GGCTTGTCTGGTTCTAGGACGGG - Intergenic
963521760 3:146365154-146365176 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
963663493 3:148154748-148154770 GGCTTGCCTGGTTTTAGGACAGG - Intergenic
963684481 3:148417445-148417467 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
964068040 3:152600543-152600565 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
964125310 3:153229302-153229324 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
964175887 3:153825891-153825913 GGCTTGTCCGGTTTTGGGACAGG + Intergenic
964906376 3:161724498-161724520 GCCTTTTCTGGTTTTAGGACAGG + Intergenic
964983762 3:162715488-162715510 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
965070473 3:163910644-163910666 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
965262508 3:166503395-166503417 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
965336478 3:167434316-167434338 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
965624739 3:170675136-170675158 GGCTTGTCTGGTTTTAGGACAGG + Intronic
965626172 3:170685943-170685965 GCCTTGGCTGGTTTTAGGACAGG + Intronic
965639891 3:170820576-170820598 GACTTGTGCGGTTTTAGGACAGG + Intronic
965713566 3:171579515-171579537 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
965861837 3:173158575-173158597 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
966066977 3:175830802-175830824 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
966085570 3:176064436-176064458 GGCTCATCTGGTTTTAGGACAGG - Intergenic
966104950 3:176324242-176324264 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
966232702 3:177668464-177668486 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
966279451 3:178210634-178210656 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
966398296 3:179523545-179523567 GACTTGTCTGGTTTTTGGACAGG + Intergenic
967152272 3:186661115-186661137 GCCTTGTCTGGTTTTAGGACAGG - Intronic
967212015 3:187178142-187178164 GGCTTGTCTGGTTTTAGGACAGG + Intronic
967244033 3:187468885-187468907 GACTTGTCTGGTTTTTGGACAGG + Intergenic
967561531 3:190923206-190923228 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
967624502 3:191669097-191669119 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
967643672 3:191897954-191897976 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
967657957 3:192073699-192073721 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
967740624 3:192998783-192998805 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
968413054 4:405824-405846 GACTTGTCTGGTTTTTGGACAGG + Intergenic
968993527 4:3930469-3930491 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
969003681 4:4002875-4002897 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
969555316 4:7904713-7904735 TGTTTGTTTTGTTTTAGGACGGG + Intronic
969749189 4:9097311-9097333 GGCTTGTCTGGTTTTAGCACAGG - Intergenic
969810246 4:9641951-9641973 GGCTTGTCTGCTTTTAGGACAGG - Intergenic
970087688 4:12366863-12366885 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
970256271 4:14173136-14173158 GGCTCATCTGGTTTTAGGACAGG + Intergenic
970532886 4:17000760-17000782 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
970853910 4:20632908-20632930 GTCTTGTCTGGTTTTAGGACGGG + Intergenic
971123037 4:23724637-23724659 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
971180701 4:24326306-24326328 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
971200283 4:24504108-24504130 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
971777491 4:30985404-30985426 GGCTAGATTGGTTATAGAACAGG + Intronic
972418880 4:38868186-38868208 GACTTGCTTGGTGCCAGGACTGG - Intronic
972664626 4:41152660-41152682 GGCTTGTTTTCTTGTAGGACTGG + Intronic
973822084 4:54670723-54670745 AACTTGCTAGGTTTTATGACTGG - Intronic
974173293 4:58293939-58293961 GGCTTGTCCGGTTTTTGGACAGG + Intergenic
974428254 4:61766913-61766935 GGCTTGTCTGGTTTTAGGACAGG + Intronic
975599728 4:76086775-76086797 AGCTGGCTTGGTTTTGGGTCAGG - Intronic
975864944 4:78716473-78716495 GGCTTCTCTGGTTTTAGGACAGG + Intergenic
975933742 4:79556590-79556612 GGCTTCTCTGGTTTTAGGACAGG + Intergenic
976558706 4:86477682-86477704 GGCTTGTCAGGTTTTTGGACAGG - Intronic
976884424 4:89967410-89967432 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
977010461 4:91627177-91627199 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
977012778 4:91657235-91657257 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
977075056 4:92441579-92441601 GGCTCGTCTGGTTTTAGGACAGG + Intronic
977198284 4:94087245-94087267 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
977217006 4:94295845-94295867 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
977225196 4:94386083-94386105 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
977515529 4:98017160-98017182 GGATGGCTTGGTGTTAGGACAGG + Intronic
977782295 4:100994397-100994419 GGCTTGTCCGGTTTTTGGACAGG + Intergenic
978000975 4:103556376-103556398 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
978031628 4:103944233-103944255 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
978438762 4:108712247-108712269 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
979054475 4:115978271-115978293 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
979146758 4:117255188-117255210 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
979171266 4:117602929-117602951 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
979380086 4:119997019-119997041 GGCTTATCTGGTTTTAGGACAGG - Intergenic
979850161 4:125564246-125564268 GGCTTGTCTGGTTTTAGTACAGG + Intergenic
979895018 4:126147758-126147780 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
980003210 4:127514064-127514086 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
980111774 4:128643480-128643502 GCCTTGTCTGGTTTTGGGACAGG + Intergenic
980285083 4:130770459-130770481 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
980302301 4:131010768-131010790 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
980389069 4:132121293-132121315 GGCTTGCCTGGTTTTAGGACAGG - Intergenic
980472295 4:133266306-133266328 GGCTTGTCTGGTTCTAGGACAGG + Intergenic
980528008 4:134015263-134015285 GGCTTTTCTGGTTCTAGGACAGG - Intergenic
980611632 4:135169913-135169935 GGCTTGTCTGGTTTCAGGACAGG + Intergenic
980904085 4:138930961-138930983 GTCTTGTCTGGTTCTAGGACAGG - Intergenic
981525360 4:145702186-145702208 GCCTTGTCTGGTTTTAGGACAGG - Intronic
981539869 4:145835843-145835865 GGCTTGTCTGGTTTTAGGACAGG - Intronic
982174710 4:152694746-152694768 GACTTGCTTGGTTTGAGGAAGGG - Intronic
982180334 4:152743946-152743968 GGCTTGTCTGGTTTTAGGACAGG + Intronic
982396582 4:154921457-154921479 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
982414057 4:155111082-155111104 GTCTTGTCTGGTTCTAGGACAGG + Intergenic
982535590 4:156603378-156603400 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
982544306 4:156713805-156713827 GGCTTTCTTGATTTCAGAACGGG - Intergenic
983055631 4:163096169-163096191 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
983056480 4:163103408-163103430 GACTTGTCTGGTTTTTGGACAGG + Intergenic
983345702 4:166523620-166523642 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
983360556 4:166719401-166719423 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
983414567 4:167438423-167438445 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
983452478 4:167925987-167926009 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
983659717 4:170119547-170119569 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
983707812 4:170680590-170680612 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
983714509 4:170762216-170762238 GGATTGTTTGGTTTCAGGGCTGG + Intergenic
983805646 4:171988644-171988666 GCCTTGCCTGGTTTTAGGACAGG + Intronic
983883617 4:172958983-172959005 GGCTTGTCTGGTTTTTGGACAGG + Intronic
984098904 4:175464054-175464076 GGCTTGTCTGGTTGTAGGACAGG + Intergenic
984165207 4:176297464-176297486 GGCTTGTCTCGTTTTAAGACAGG + Intergenic
984322333 4:178210185-178210207 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
984393469 4:179167507-179167529 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
984437410 4:179723543-179723565 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
984700823 4:182817616-182817638 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
985040271 4:185884606-185884628 GCCTTTCTGGGTTTCAGGACTGG + Intronic
985057248 4:186046815-186046837 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
985078861 4:186244727-186244749 GGCTTGTCCGGTTTTTGGACAGG + Intronic
985389719 4:189482080-189482102 GGCTTGTCTGGCTTTAGGACAGG + Intergenic
985435857 4:189928951-189928973 GGCTTGTCTGGCTTTAGGACAGG - Intergenic
985582498 5:705883-705905 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
986193676 5:5518640-5518662 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
986389025 5:7266681-7266703 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
986554899 5:9001159-9001181 GGCTTGTCTGGTTTTAGCACAGG + Intergenic
986919439 5:12665153-12665175 GACTTGTCTGGTTTTAGGACGGG + Intergenic
987486983 5:18536773-18536795 CGCTTGTCTGGTTTTAGGACAGG - Intergenic
987487639 5:18541407-18541429 GGCTTGTCTGGTTTTAGAACAGG - Intergenic
987497979 5:18671471-18671493 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
987755969 5:22097934-22097956 GCCTTGTCTGGTTTTAGGACAGG - Intronic
989660067 5:43789199-43789221 GACTTGCCTGGTTTTTGGACAGG - Intergenic
990795790 5:59539009-59539031 GTCATCCTTGATTTTAGGACTGG - Intronic
992394812 5:76360452-76360474 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
992451853 5:76883002-76883024 GGCTTGTCTTGTTTTAGGACAGG + Intronic
992960973 5:81956351-81956373 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
993192865 5:84701573-84701595 GGCTTGTCTGATTTTAGGACAGG - Intergenic
993363204 5:87003274-87003296 GGGTGGCTTGGTTTCTGGACTGG - Intergenic
993836839 5:92827056-92827078 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
994295285 5:98082163-98082185 GTCTTGTCTAGTTTTAGGACAGG - Intergenic
994532400 5:100986871-100986893 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
994775825 5:104034706-104034728 GACTTGTCTGGTTTTAGGACAGG - Intergenic
994778807 5:104066815-104066837 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
994989697 5:106981460-106981482 ACCTTGTCTGGTTTTAGGACAGG - Intergenic
995122651 5:108552370-108552392 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
995125018 5:108571084-108571106 GGCTTGTCTGGTTCTAGAACAGG + Intergenic
995296816 5:110532936-110532958 ACCTTGTCTGGTTTTAGGACAGG - Intronic
995776339 5:115728032-115728054 GCCTTTCTTGGTTGTAGGAGGGG + Intergenic
996203111 5:120700202-120700224 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
996344673 5:122476217-122476239 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
996358470 5:122621482-122621504 GCTTTGTCTGGTTTTAGGACAGG + Intergenic
996510041 5:124306883-124306905 GCTTTGTCTGGTTTTAGGACAGG - Intergenic
996528194 5:124500147-124500169 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
996574843 5:124969223-124969245 GCCTTGTCTGGTTTTAGGACTGG + Intergenic
996725721 5:126672204-126672226 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
996745292 5:126842169-126842191 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
996917822 5:128732602-128732624 GGCTTGTCTGGTTTTAGGACAGG - Intronic
997678656 5:135733982-135734004 GGCTTTTCTGGTTTTAGGACAGG + Intergenic
997769540 5:136542225-136542247 GGCTTGTCTCGTTTTAGGACAGG + Intergenic
997770487 5:136548943-136548965 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
998693555 5:144613967-144613989 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
998995535 5:147866384-147866406 GACTTGTCTGGTTTTAGGACAGG - Intergenic
998996254 5:147871600-147871622 GACTTGTCTGGTTTTAGGACAGG + Intronic
999618725 5:153452322-153452344 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1000438720 5:161243065-161243087 GGCTTGTCTGGTTGTAGGACAGG - Intergenic
1000439865 5:161251589-161251611 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1000519264 5:162278013-162278035 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1000607084 5:163337117-163337139 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1000885180 5:166741710-166741732 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1000935491 5:167300505-167300527 GTCTTGTCTGGTTTTAGGACAGG + Intronic
1001717269 5:173826431-173826453 GGCTTGCTTGGTTCTTGGTATGG + Intergenic
1002006252 5:176237477-176237499 TGGTTGGTTGGTTTTAGGGCAGG - Intergenic
1002764481 6:227280-227302 GGCCTGCGTGGTTTCAGGACGGG - Intergenic
1003312681 6:4983292-4983314 GGCTTTCCTTGTTTTAGGACAGG - Intergenic
1003430027 6:6030405-6030427 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1004106406 6:12670455-12670477 GCCTTGTCTGGTTTTAGAACAGG - Intergenic
1004283375 6:14299570-14299592 AGCTTGTCTGGTTTTAGGACAGG + Intergenic
1004507848 6:16261606-16261628 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1004575366 6:16889044-16889066 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
1004768428 6:18756684-18756706 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1004837149 6:19541999-19542021 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1006324991 6:33346921-33346943 GGCTTATCTGGTTTTTGGACAGG - Intergenic
1007084547 6:39134216-39134238 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1007871519 6:45044716-45044738 GGCCTGCTGGGTTTCAGGCCAGG + Intronic
1008476732 6:51941606-51941628 GCCTTGTCTGGTTTTAGGACAGG - Intronic
1009269961 6:61603197-61603219 GGCCTGTCTGGTTTTAGGACAGG - Intergenic
1009359491 6:62794602-62794624 GGCTTGTCCGGTTTTTGGACAGG - Intergenic
1009379286 6:63008395-63008417 GGCTTGTCCAGTTTTAGGACAGG - Intergenic
1009750172 6:67871638-67871660 GACTTGTGTGGTTTTTGGACAGG + Intergenic
1010071577 6:71751165-71751187 GCCTGGTCTGGTTTTAGGACAGG + Intergenic
1010340594 6:74747413-74747435 GGGTTTCTTGTTTTTAGGAGTGG + Intergenic
1010586546 6:77663168-77663190 GGCTTGCCTGGTTTTAGGACAGG + Intergenic
1010662456 6:78586483-78586505 GGCTTGTCTGGTTTTAAGACAGG - Intergenic
1010826717 6:80484739-80484761 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
1010829550 6:80512919-80512941 GGCTTATCTGGTTTTAGGACAGG + Intergenic
1010894399 6:81347760-81347782 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1011367754 6:86600988-86601010 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1011770793 6:90672825-90672847 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1012014242 6:93832691-93832713 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1012066395 6:94556557-94556579 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1012315965 6:97782678-97782700 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1012675240 6:102105049-102105071 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1012689724 6:102296024-102296046 GCCTTTTCTGGTTTTAGGACAGG - Intergenic
1013407743 6:109858378-109858400 GGCTAGTCTGGTTTTAGGACAGG + Intergenic
1013807938 6:114014955-114014977 GGCTTGTCTGGTTTTTGGACAGG + Intergenic
1013843560 6:114425090-114425112 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1013891856 6:115034977-115034999 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1014115202 6:117662334-117662356 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1014360017 6:120464896-120464918 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1014396213 6:120928270-120928292 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1014454721 6:121623052-121623074 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1014555993 6:122842922-122842944 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1014612230 6:123559723-123559745 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1014614528 6:123584907-123584929 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1014719042 6:124895134-124895156 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1014793842 6:125704478-125704500 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1014891688 6:126851841-126851863 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1015071577 6:129100169-129100191 GGCTGACTTGGTTTAAGGAATGG - Intronic
1015266891 6:131298545-131298567 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1015271519 6:131341964-131341986 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1015278302 6:131405910-131405932 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1015287898 6:131506897-131506919 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1015323977 6:131904780-131904802 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1015375727 6:132508180-132508202 TGCTTGCATGGTTTTGAGACAGG - Intronic
1015801236 6:137063943-137063965 GGCTTCTCTGGTTCTAGGACAGG + Intergenic
1016204676 6:141455909-141455931 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1016249010 6:142018903-142018925 GGCTTGTCTGGTTTTCGGACAGG - Intergenic
1016518951 6:144926265-144926287 GGCTTGTCTGATTTTAGGACAGG - Intergenic
1016535614 6:145105767-145105789 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1016853417 6:148642897-148642919 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1017779197 6:157703269-157703291 GCCTTGTCTGGTTTTAGGACAGG + Intronic
1018023724 6:159788520-159788542 GGCTCGCTTTGTTTAGGGACAGG - Intronic
1018077750 6:160231592-160231614 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1018084351 6:160289189-160289211 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1018495247 6:164341354-164341376 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1018521325 6:164654771-164654793 GTCTTGTCTGGTTTTAGGACGGG + Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020246451 7:6432981-6433003 TGCCTGCTGGGTTTTATGACAGG - Intronic
1020316190 7:6906875-6906897 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1020323814 7:6959329-6959351 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1020532572 7:9356038-9356060 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1020540998 7:9461175-9461197 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1021172818 7:17416934-17416956 GGCTTGTCCGGTTTTTGGACAGG - Intergenic
1021393764 7:20123690-20123712 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1021429992 7:20548536-20548558 GGATTGTCTGGTTTTAGGACAGG - Intergenic
1021500610 7:21329066-21329088 GGCTTTCTTGATTTTAGGCAAGG - Intergenic
1021810799 7:24399364-24399386 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1021977749 7:26026810-26026832 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1022447546 7:30482315-30482337 GGCTTGTCCGGTTTTTGGACAGG - Intergenic
1022572649 7:31469648-31469670 GGCTTATCTGGTTTTAGGACAGG + Intergenic
1022709222 7:32835468-32835490 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1022709892 7:32840528-32840550 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1023698741 7:42873229-42873251 GGTTTGTCTGGTTTTAGGACAGG + Intergenic
1027158460 7:75785020-75785042 GACTTGTCTGGTTTTTGGACAGG - Intronic
1027354567 7:77342790-77342812 GGCTTGTCTGGTTTTTGGACAGG - Intronic
1027852098 7:83462758-83462780 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1028043808 7:86091114-86091136 GCCTTTCTTGGTTGTAGGAGAGG - Intergenic
1028169169 7:87575107-87575129 GTCTTGCTTGGGTTTAGAAAAGG - Intronic
1028670653 7:93397028-93397050 GCCTTGTCTGGTTTTAGAACAGG - Intergenic
1028690317 7:93642953-93642975 GCCTTGTCTGGTTTTAGGACAGG - Intronic
1030441543 7:109594644-109594666 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1030445648 7:109644778-109644800 GGCTTGTCCGTTTTTAGGACAGG + Intergenic
1030751356 7:113236201-113236223 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1031004819 7:116458598-116458620 GCCTTGTCTGGTTTTAGGACAGG - Intronic
1031296758 7:120011975-120011997 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1031364613 7:120888234-120888256 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1031400130 7:121318649-121318671 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1031525737 7:122820018-122820040 GGCTTGTCTGGTTTTAGGACAGG - Intronic
1031685988 7:124732127-124732149 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1031727796 7:125261522-125261544 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1031776468 7:125913086-125913108 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1031777477 7:125920669-125920691 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
1031842924 7:126768307-126768329 GCTGTGCTTGTTTTTAGGACAGG - Intronic
1032695695 7:134334269-134334291 GGCTTGCGTGGTTTTACAGCAGG - Intergenic
1032754092 7:134871938-134871960 GGCTTGCATGTGCTTAGGACTGG + Intronic
1033084862 7:138332117-138332139 GACTTGTCTGGTTTTAGGACAGG - Intergenic
1033088693 7:138365617-138365639 GGCCTGTCTGGTTTTTGGACAGG - Intergenic
1033211662 7:139464377-139464399 TACTTGTCTGGTTTTAGGACAGG - Intronic
1033464898 7:141581441-141581463 TGCTTGTCTGGTTTTTGGACAGG + Intronic
1033675800 7:143539839-143539861 GGCTTATCTGGTTTTAGGACAGG + Intergenic
1033696033 7:143789605-143789627 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1033875802 7:145817432-145817454 GGCTTTCATGGTTTTAGAAAAGG - Intergenic
1033909326 7:146245999-146246021 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1034084674 7:148312665-148312687 GCCTTGTCTGGTTTTAGGACAGG + Intronic
1034184171 7:149161557-149161579 GTTTTGCTTGTTTTTAAGACAGG - Intronic
1034406956 7:150910869-150910891 GGCTCGCCTTGTTTTTGGACTGG + Intergenic
1034409175 7:150929998-150930020 GACTTTCTTGGTTTTAGCAGTGG + Intergenic
1035880526 8:3240829-3240851 GGCTTGTCTGGTTCTAGAACAGG + Intronic
1036070774 8:5439254-5439276 GACTTGTCTGGTTCTAGGACAGG + Intergenic
1036281624 8:7405530-7405552 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1036339846 8:7906042-7906064 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1036372255 8:8171655-8171677 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1036639629 8:10574361-10574383 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1036878647 8:12493986-12494008 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1042337801 8:67646820-67646842 GGCTTGCCCTGTTTGAGGACAGG + Intronic
1042706220 8:71667452-71667474 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1042707520 8:71678007-71678029 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1043353514 8:79388719-79388741 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1043717755 8:83507765-83507787 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1043837873 8:85066065-85066087 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1044148376 8:88744827-88744849 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1044258472 8:90092828-90092850 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1044925307 8:97204012-97204034 GGCTCTTCTGGTTTTAGGACAGG - Intergenic
1045197674 8:99946967-99946989 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1045644928 8:104289029-104289051 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1045879010 8:107015437-107015459 GGCTGGCATGGTTCTAGGGCAGG - Intergenic
1046294265 8:112198920-112198942 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1046386196 8:113512128-113512150 GGCTTGTCTGGTTTTACGACAGG + Intergenic
1046440158 8:114244434-114244456 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1046443393 8:114285082-114285104 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1046512225 8:115215322-115215344 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1046559421 8:115817695-115817717 CCCTTGCCTGGTTTTAGGACAGG - Intergenic
1047699494 8:127434813-127434835 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1047829401 8:128614531-128614553 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1047856520 8:128917509-128917531 GGCTTCTCTGGTTCTAGGACAGG - Intergenic
1048097744 8:131313290-131313312 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1048135608 8:131743817-131743839 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1048168286 8:132082849-132082871 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1048201453 8:132377581-132377603 GGCTTGCTTGTTTCTAGCTCTGG + Intronic
1048585281 8:135769766-135769788 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1048728280 8:137410890-137410912 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1048764094 8:137827439-137827461 GGCTTGTCTGGTTTTAAGACAGG + Intergenic
1049868679 8:144956880-144956902 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1050117757 9:2278657-2278679 GCCTCGTCTGGTTTTAGGACAGG - Intergenic
1050140625 9:2512525-2512547 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1050257962 9:3813782-3813804 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1051052775 9:12951440-12951462 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1051953263 9:22661184-22661206 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1052163227 9:25290762-25290784 GTCTTGTCTGGTTTCAGGACAGG - Intergenic
1052191977 9:25672014-25672036 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1052653487 9:31329504-31329526 GCCTTGTCTGGTTTTAGAACAGG - Intergenic
1052720498 9:32167143-32167165 GGTTTGTCTGGTTTTAGGACAGG + Intergenic
1053052116 9:34970768-34970790 GACTAAATTGGTTTTAGGACAGG + Intronic
1053058173 9:35006580-35006602 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
1054807343 9:69407364-69407386 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1055233214 9:74088756-74088778 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1055347569 9:75354398-75354420 GCCTTGTCTGGTTTTAGGAGAGG + Intergenic
1055460474 9:76515510-76515532 TGCTTGTTTGTTTTTAAGACAGG + Intergenic
1055626868 9:78183905-78183927 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1055810200 9:80140508-80140530 GGCTTGTCTGGTTTTAGGAGAGG - Intergenic
1055881882 9:81012104-81012126 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1056044585 9:82703334-82703356 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1056061302 9:82886843-82886865 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1056324036 9:85461740-85461762 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1056522595 9:87414019-87414041 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1056883124 9:90415670-90415692 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1057234994 9:93350703-93350725 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1057378133 9:94542908-94542930 GGCTCGTCGGGTTTTAGGACAGG - Intergenic
1057684143 9:97217929-97217951 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1057812437 9:98268428-98268450 GCCTTGCCTGGTTTTAGGACAGG + Intergenic
1057902281 9:98958782-98958804 GGATTCCTTGGTTCTAGGCCTGG + Intronic
1057982232 9:99673255-99673277 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1058026055 9:100143308-100143330 GCCTTGTCTGGTTTTAGGACAGG + Intronic
1059546030 9:115177237-115177259 GCCTTGTCTGGTTTTAGGACAGG + Intronic
1059574760 9:115476442-115476464 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1059606558 9:115841817-115841839 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1059863342 9:118488285-118488307 GGCTTATCTGGTTTTAGGACAGG + Intergenic
1060318330 9:122533251-122533273 GTCTTGTCTGGTTTTAGGACAGG + Intergenic
1060737733 9:126077241-126077263 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1061583213 9:131550166-131550188 GGCTTGCCTGGTTTTCGGACAGG - Intergenic
1185858283 X:3555747-3555769 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1185960545 X:4543096-4543118 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1185991201 X:4894679-4894701 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1186112704 X:6274799-6274821 GACTTGTCCGGTTTTAGGACAGG + Intergenic
1186360671 X:8837645-8837667 GGCTTCTGTGCTTTTAGGACGGG - Intergenic
1186784221 X:12942932-12942954 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1187086377 X:16047304-16047326 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1187099819 X:16181783-16181805 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1187580003 X:20597185-20597207 GACTGTCTTGGTTTTAGCACTGG + Intergenic
1188134666 X:26480775-26480797 GGTTTGGTTGGTTTTAAGACAGG - Intergenic
1188332870 X:28895232-28895254 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1188419644 X:29978433-29978455 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1188431173 X:30106442-30106464 GGCTTGTCTGGTTCTAGGACAGG - Intergenic
1188463238 X:30451715-30451737 GGCTTGTCTGGTTCTAGGAAAGG + Intergenic
1189499385 X:41541444-41541466 GGCTTTTTTGGTTTTATGAAGGG - Intronic
1189568678 X:42272056-42272078 GGGTTGCTTCCTTTTAGGAGTGG + Intergenic
1191014046 X:55790950-55790972 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1191761428 X:64652007-64652029 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1191873813 X:65773403-65773425 GGGTTGCTTGCCTTTGGGACTGG + Intergenic
1192454785 X:71267579-71267601 GACTTGTCTGGTTTTTGGACAGG - Intergenic
1192706288 X:73530770-73530792 GGCTTGTCTGGTTTTTGGACAGG - Intergenic
1193598538 X:83478931-83478953 TGCTTGCTTGTTTTTGAGACAGG - Intergenic
1193763295 X:85492748-85492770 GGTTTGTTTGGTTTGAGGATTGG + Intergenic
1193941644 X:87684988-87685010 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1194186104 X:90775939-90775961 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1194293474 X:92102858-92102880 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1194308398 X:92275681-92275703 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1194351433 X:92827588-92827610 GGCTTGTCTGCTTTTAGGACAGG - Intergenic
1194502833 X:94701437-94701459 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1194805772 X:98325917-98325939 GGCTTCATTGCTTTTAGGACAGG + Intergenic
1194822625 X:98526882-98526904 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1194873654 X:99162048-99162070 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1195291014 X:103432147-103432169 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1195841640 X:109181515-109181537 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1195908531 X:109867839-109867861 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1196073232 X:111547017-111547039 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1196165691 X:112533710-112533732 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1196220843 X:113111334-113111356 GACTTGTCTGGTTTTAGGACAGG + Intergenic
1196227072 X:113179410-113179432 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1196300152 X:114043078-114043100 GTCTTGTCTGGTTTTAGGACAGG - Intergenic
1196330969 X:114469857-114469879 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1196341569 X:114603914-114603936 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1196418609 X:115499752-115499774 GGTGTGCTTGATTTTAGAACTGG - Intergenic
1196497008 X:116333921-116333943 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1196525330 X:116723573-116723595 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1196533402 X:116815100-116815122 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1196572644 X:117282248-117282270 GGCTTGTCTGGTTTTACGACAGG - Intergenic
1196773722 X:119320394-119320416 GGCTTGTCTGGTTTTAGGAGAGG + Intergenic
1197065060 X:122225130-122225152 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1197351911 X:125391460-125391482 GGCTTGTCTGGTTTTAGGACAGG + Intergenic
1197471114 X:126866191-126866213 GGCTTGTCTGGCTTTAGGAAAGG - Intergenic
1197499863 X:127229686-127229708 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1198598588 X:138261903-138261925 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1198599253 X:138266933-138266955 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1198983610 X:142426185-142426207 GGCTTGTCTGGTTCTAGGACAGG + Intergenic
1199153333 X:144516449-144516471 GGCATGCATGGGTTTAGGAGAGG - Intergenic
1199576624 X:149318755-149318777 GCCTTGTCTGGTTTTAGGACAGG - Intergenic
1200532697 Y:4358019-4358041 GCCTTGTCTGGTTTTAGGACAGG + Intergenic
1200610993 Y:5327404-5327426 GGCTTGTCTGGTTTTAGGACAGG + Intronic
1200659753 Y:5944280-5944302 GGCTTGTCTGGTTTTAGGACAGG - Intergenic
1200812983 Y:7503822-7503844 GTCTTGTCTGGTTTTTGGACAGG - Intergenic
1201234120 Y:11893753-11893775 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1201307376 Y:12562569-12562591 GACTTGTCTGGTTTTTGGACAGG + Intergenic
1201473401 Y:14357164-14357186 GGCTTGTCTGGTTTTAGGACGGG + Intergenic
1201581526 Y:15515474-15515496 GGCTTGTCTGGTTTTAGGACAGG - Intergenic