ID: 929076529

View in Genome Browser
Species Human (GRCh38)
Location 2:38083379-38083401
Sequence GGCTTGCTTGGTTTTAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 6, 2: 325, 3: 283, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929076526_929076529 -6 Left 929076526 2:38083362-38083384 CCTGAACTAACTTGTAAGGCTTG 0: 256
1: 183
2: 209
3: 141
4: 134
Right 929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG 0: 1
1: 6
2: 325
3: 283
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929076529 Original CRISPR GGCTTGCTTGGTTTTAGGAC AGG Intronic