ID: 929081498

View in Genome Browser
Species Human (GRCh38)
Location 2:38126921-38126943
Sequence AAACCATTAAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5991
Summary {0: 11, 1: 384, 2: 2111, 3: 2125, 4: 1360}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929081498_929081500 3 Left 929081498 2:38126921-38126943 CCTAGAGACTTGTTTAATGGTTT 0: 11
1: 384
2: 2111
3: 2125
4: 1360
Right 929081500 2:38126947-38126969 CCAAAATGCTCATAGTGATATGG 0: 17
1: 1076
2: 1778
3: 1494
4: 1065
929081498_929081503 18 Left 929081498 2:38126921-38126943 CCTAGAGACTTGTTTAATGGTTT 0: 11
1: 384
2: 2111
3: 2125
4: 1360
Right 929081503 2:38126962-38126984 TGATATGGGCAGAGATGGCCAGG No data
929081498_929081502 13 Left 929081498 2:38126921-38126943 CCTAGAGACTTGTTTAATGGTTT 0: 11
1: 384
2: 2111
3: 2125
4: 1360
Right 929081502 2:38126957-38126979 CATAGTGATATGGGCAGAGATGG No data
929081498_929081504 27 Left 929081498 2:38126921-38126943 CCTAGAGACTTGTTTAATGGTTT 0: 11
1: 384
2: 2111
3: 2125
4: 1360
Right 929081504 2:38126971-38126993 CAGAGATGGCCAGGCTGATGAGG 0: 7
1: 17
2: 43
3: 181
4: 691
929081498_929081501 4 Left 929081498 2:38126921-38126943 CCTAGAGACTTGTTTAATGGTTT 0: 11
1: 384
2: 2111
3: 2125
4: 1360
Right 929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929081498 Original CRISPR AAACCATTAAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr