ID: 929081501

View in Genome Browser
Species Human (GRCh38)
Location 2:38126948-38126970
Sequence CAAAATGCTCATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929081498_929081501 4 Left 929081498 2:38126921-38126943 CCTAGAGACTTGTTTAATGGTTT 0: 11
1: 384
2: 2111
3: 2125
4: 1360
Right 929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929081501 Original CRISPR CAAAATGCTCATAGTGATAT GGG Intergenic
No off target data available for this crispr