ID: 929086835

View in Genome Browser
Species Human (GRCh38)
Location 2:38176414-38176436
Sequence CTGTCTAACTAAAATTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929086826_929086835 30 Left 929086826 2:38176361-38176383 CCTCTCACCTCAGCCAAGTATCT No data
Right 929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG No data
929086832_929086835 -8 Left 929086832 2:38176399-38176421 CCTCACCACTCCTGGCTGTCTAA No data
Right 929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG No data
929086830_929086835 17 Left 929086830 2:38176374-38176396 CCAAGTATCTGGAACTGCAGGTG No data
Right 929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG No data
929086828_929086835 23 Left 929086828 2:38176368-38176390 CCTCAGCCAAGTATCTGGAACTG No data
Right 929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929086835 Original CRISPR CTGTCTAACTAAAATTATGA AGG Intergenic
No off target data available for this crispr