ID: 929087817

View in Genome Browser
Species Human (GRCh38)
Location 2:38185846-38185868
Sequence CCCTCCTCTCCAAAAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929087817_929087822 21 Left 929087817 2:38185846-38185868 CCTTTCCTTTTTGGAGAGGAGGG No data
Right 929087822 2:38185890-38185912 CTAGCAAGATGACGTAGGGCTGG No data
929087817_929087821 17 Left 929087817 2:38185846-38185868 CCTTTCCTTTTTGGAGAGGAGGG No data
Right 929087821 2:38185886-38185908 CTATCTAGCAAGATGACGTAGGG No data
929087817_929087820 16 Left 929087817 2:38185846-38185868 CCTTTCCTTTTTGGAGAGGAGGG No data
Right 929087820 2:38185885-38185907 TCTATCTAGCAAGATGACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929087817 Original CRISPR CCCTCCTCTCCAAAAAGGAA AGG (reversed) Intergenic