ID: 929087819

View in Genome Browser
Species Human (GRCh38)
Location 2:38185851-38185873
Sequence TTTTTCCCTCCTCTCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929087819_929087820 11 Left 929087819 2:38185851-38185873 CCTTTTTGGAGAGGAGGGAAAAA No data
Right 929087820 2:38185885-38185907 TCTATCTAGCAAGATGACGTAGG No data
929087819_929087822 16 Left 929087819 2:38185851-38185873 CCTTTTTGGAGAGGAGGGAAAAA No data
Right 929087822 2:38185890-38185912 CTAGCAAGATGACGTAGGGCTGG No data
929087819_929087821 12 Left 929087819 2:38185851-38185873 CCTTTTTGGAGAGGAGGGAAAAA No data
Right 929087821 2:38185886-38185908 CTATCTAGCAAGATGACGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929087819 Original CRISPR TTTTTCCCTCCTCTCCAAAA AGG (reversed) Intergenic
No off target data available for this crispr