ID: 929087822

View in Genome Browser
Species Human (GRCh38)
Location 2:38185890-38185912
Sequence CTAGCAAGATGACGTAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929087817_929087822 21 Left 929087817 2:38185846-38185868 CCTTTCCTTTTTGGAGAGGAGGG No data
Right 929087822 2:38185890-38185912 CTAGCAAGATGACGTAGGGCTGG No data
929087819_929087822 16 Left 929087819 2:38185851-38185873 CCTTTTTGGAGAGGAGGGAAAAA No data
Right 929087822 2:38185890-38185912 CTAGCAAGATGACGTAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929087822 Original CRISPR CTAGCAAGATGACGTAGGGC TGG Intergenic
No off target data available for this crispr