ID: 929088742

View in Genome Browser
Species Human (GRCh38)
Location 2:38194093-38194115
Sequence CAACCAGGGGGAGCAATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929088742_929088752 29 Left 929088742 2:38194093-38194115 CCCATCATTGCTCCCCCTGGTTG No data
Right 929088752 2:38194145-38194167 ATTTCCCCTTTGTCCTCTGAAGG No data
929088742_929088748 -5 Left 929088742 2:38194093-38194115 CCCATCATTGCTCCCCCTGGTTG No data
Right 929088748 2:38194111-38194133 GGTTGAACCTCGTCCTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929088742 Original CRISPR CAACCAGGGGGAGCAATGAT GGG (reversed) Intergenic
No off target data available for this crispr