ID: 929089305

View in Genome Browser
Species Human (GRCh38)
Location 2:38198981-38199003
Sequence GGGAGCAGAAATTTTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929089305_929089311 7 Left 929089305 2:38198981-38199003 CCAATCTCAAAATTTCTGCTCCC No data
Right 929089311 2:38199011-38199033 CTTTCCTGATGCCGTGCTGCCGG No data
929089305_929089312 8 Left 929089305 2:38198981-38199003 CCAATCTCAAAATTTCTGCTCCC No data
Right 929089312 2:38199012-38199034 TTTCCTGATGCCGTGCTGCCGGG No data
929089305_929089315 20 Left 929089305 2:38198981-38199003 CCAATCTCAAAATTTCTGCTCCC No data
Right 929089315 2:38199024-38199046 GTGCTGCCGGGCACAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929089305 Original CRISPR GGGAGCAGAAATTTTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr