ID: 929090688

View in Genome Browser
Species Human (GRCh38)
Location 2:38214364-38214386
Sequence ATCCAGCTGGGGCTTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929090688_929090696 28 Left 929090688 2:38214364-38214386 CCCAGATGAAGCCCCAGCTGGAT No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929090688 Original CRISPR ATCCAGCTGGGGCTTCATCT GGG (reversed) Intergenic
No off target data available for this crispr