ID: 929090690

View in Genome Browser
Species Human (GRCh38)
Location 2:38214375-38214397
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929090690_929090696 17 Left 929090690 2:38214375-38214397 CCCCAGCTGGATGCCTGAGCTGT No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929090690 Original CRISPR ACAGCTCAGGCATCCAGCTG GGG (reversed) Intergenic
No off target data available for this crispr