ID: 929090693

View in Genome Browser
Species Human (GRCh38)
Location 2:38214388-38214410
Sequence TAGGGTTAAAAAAACAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929090693_929090696 4 Left 929090693 2:38214388-38214410 CCTGAGCTGTTTTTTTAACCCTA No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929090693 Original CRISPR TAGGGTTAAAAAAACAGCTC AGG (reversed) Intergenic
No off target data available for this crispr