ID: 929090696

View in Genome Browser
Species Human (GRCh38)
Location 2:38214415-38214437
Sequence GATCTGTCATTAAACCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929090692_929090696 15 Left 929090692 2:38214377-38214399 CCAGCTGGATGCCTGAGCTGTTT No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data
929090689_929090696 27 Left 929090689 2:38214365-38214387 CCAGATGAAGCCCCAGCTGGATG No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data
929090693_929090696 4 Left 929090693 2:38214388-38214410 CCTGAGCTGTTTTTTTAACCCTA No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data
929090688_929090696 28 Left 929090688 2:38214364-38214386 CCCAGATGAAGCCCCAGCTGGAT No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data
929090687_929090696 29 Left 929090687 2:38214363-38214385 CCCCAGATGAAGCCCCAGCTGGA No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data
929090691_929090696 16 Left 929090691 2:38214376-38214398 CCCAGCTGGATGCCTGAGCTGTT No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data
929090690_929090696 17 Left 929090690 2:38214375-38214397 CCCCAGCTGGATGCCTGAGCTGT No data
Right 929090696 2:38214415-38214437 GATCTGTCATTAAACCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929090696 Original CRISPR GATCTGTCATTAAACCTTAC TGG Intergenic
No off target data available for this crispr