ID: 929093545

View in Genome Browser
Species Human (GRCh38)
Location 2:38242916-38242938
Sequence TACCCTGTGCTGTGAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929093545_929093547 23 Left 929093545 2:38242916-38242938 CCAGGATCTCACAGCACAGGGTA No data
Right 929093547 2:38242962-38242984 TTGCTTTCAAAACCATAAAAAGG No data
929093545_929093549 29 Left 929093545 2:38242916-38242938 CCAGGATCTCACAGCACAGGGTA No data
Right 929093549 2:38242968-38242990 TCAAAACCATAAAAAGGGAAAGG No data
929093545_929093548 24 Left 929093545 2:38242916-38242938 CCAGGATCTCACAGCACAGGGTA No data
Right 929093548 2:38242963-38242985 TGCTTTCAAAACCATAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929093545 Original CRISPR TACCCTGTGCTGTGAGATCC TGG (reversed) Intergenic
No off target data available for this crispr