ID: 929093849

View in Genome Browser
Species Human (GRCh38)
Location 2:38245597-38245619
Sequence CTGTACATCCTCAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929093844_929093849 24 Left 929093844 2:38245550-38245572 CCACAGCATTCCAAAGATTCGAA No data
Right 929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG No data
929093845_929093849 14 Left 929093845 2:38245560-38245582 CCAAAGATTCGAATGATTCTAAG No data
Right 929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929093849 Original CRISPR CTGTACATCCTCAGGAAGGA AGG Intergenic
No off target data available for this crispr