ID: 929093966

View in Genome Browser
Species Human (GRCh38)
Location 2:38246599-38246621
Sequence AATGAGAAGCCCATCGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929093965_929093966 -7 Left 929093965 2:38246583-38246605 CCTCTGGCTGGCTGGCAATGAGA No data
Right 929093966 2:38246599-38246621 AATGAGAAGCCCATCGATGATGG No data
929093964_929093966 -6 Left 929093964 2:38246582-38246604 CCCTCTGGCTGGCTGGCAATGAG No data
Right 929093966 2:38246599-38246621 AATGAGAAGCCCATCGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929093966 Original CRISPR AATGAGAAGCCCATCGATGA TGG Intergenic
No off target data available for this crispr