ID: 929100584

View in Genome Browser
Species Human (GRCh38)
Location 2:38308458-38308480
Sequence AAAGGTAGTCAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929100584 Original CRISPR AAAGGTAGTCAGAGGGTGGA GGG Intronic
900315058 1:2052268-2052290 AAAGCAAGGCAGAGGGAGGACGG - Intronic
900339941 1:2183484-2183506 AGAGGGAGTGAGAGGGTGAATGG + Intronic
900503465 1:3017731-3017753 ACAAGTAGTCAGAGGGTCGAAGG + Intergenic
902811395 1:18889993-18890015 AAAGGTAATGGGAGGGTGGGAGG - Exonic
903057099 1:20643741-20643763 TAAGGTTGTCAAAGTGTGGAAGG - Intronic
904245989 1:29188532-29188554 ATAGGTAGTCACTGGGTGGATGG + Intergenic
905179800 1:36158414-36158436 AAAGGAACTCAGAGGGAGCAGGG - Intronic
905241295 1:36583236-36583258 AAAGGGAGTGAGTGGGTGGGTGG - Intergenic
905844119 1:41212240-41212262 AAAGGTAATGAGTGGATGGAAGG + Intronic
905854231 1:41297007-41297029 AATTGTAATCAGAGGGTGGTTGG + Intergenic
906047986 1:42847111-42847133 CAAGGAAGTCAGAGGGTCGCAGG - Intronic
907338490 1:53716288-53716310 AGAGGGAGGCAGAGGGTTGAAGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
909386307 1:75061102-75061124 AAGGGTAGTGTGAGGGTGGGAGG - Intergenic
909431607 1:75593835-75593857 AAGGGTAGTCAGGGGATGGAGGG + Intronic
910132164 1:83920922-83920944 AAAGGTAGTCAGCAGGGAGATGG - Intronic
910467840 1:87519119-87519141 AAAGGTTGTCCGTAGGTGGAGGG - Intergenic
910819734 1:91333455-91333477 AAGGGTAGTGGGAGGGTGGAGGG + Intronic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
912173301 1:107126847-107126869 AAAATAAGTCAGAGGGAGGAAGG - Intergenic
912177014 1:107171724-107171746 GCAGGTTTTCAGAGGGTGGATGG - Intronic
912391051 1:109303251-109303273 CTAGGTAGTGAGAGGGTGGTAGG - Intronic
912412849 1:109490077-109490099 AATGGCAGTCAGGGGGTGGGTGG - Exonic
912626111 1:111205307-111205329 AGAGGTAGGCAGAGGGAAGAAGG + Intronic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
913684669 1:121220410-121220432 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
914036505 1:144008026-144008048 GAAGCTGGGCAGAGGGTGGAAGG + Intergenic
914152949 1:145059920-145059942 GAAGCTGGGCAGAGGGTGGAAGG - Intronic
914505191 1:148282362-148282384 CAAGGCAGTCAGAGACTGGACGG - Intergenic
914507374 1:148301786-148301808 CAAGGCAGTCAGAGACTGGACGG + Intergenic
915504981 1:156348970-156348992 AAAGGTAATCAGAGGATGACTGG + Intronic
916322510 1:163520783-163520805 AAGGGTAGTCAGAGGTTAGGGGG + Intergenic
916334909 1:163660083-163660105 AAGGGTAGTGAGAGTGTGGTAGG - Intergenic
917141733 1:171841893-171841915 AGCGGGAGCCAGAGGGTGGATGG + Intronic
917950308 1:180025951-180025973 AAAAGTCTTCAGGGGGTGGAAGG + Intronic
918345895 1:183606763-183606785 AAAGGTAGGCAGCGGGGGGCAGG + Intergenic
918739427 1:188108299-188108321 AAAGGTAGTCAGAATGTAGGAGG - Intergenic
919506589 1:198406449-198406471 GAAGATTCTCAGAGGGTGGAGGG + Intergenic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
920471980 1:206238960-206238982 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
920940836 1:210480728-210480750 AAAGGGAAGCAGAGGCTGGATGG - Intronic
923100490 1:230810680-230810702 AGAGGTTGCCAGAGGCTGGATGG - Intergenic
923289636 1:232531861-232531883 AAAGGAAGGGAGAGGGAGGAGGG + Intronic
923452861 1:234136157-234136179 GAAGGAAGAAAGAGGGTGGAGGG - Intronic
923759079 1:236823623-236823645 TAAGGTTGTCAGTGGGTGGTGGG - Intronic
923834988 1:237601097-237601119 AAAGGAAATCAGTGTGTGGAAGG + Intronic
1063452744 10:6162554-6162576 AAAGCTAGTAAAAGGGAGGATGG - Intronic
1063464630 10:6234823-6234845 TTAGGTAGTCAGAGGGGAGAGGG - Exonic
1064331370 10:14397261-14397283 AAAGCTATTCAGGGGCTGGAAGG + Intronic
1064566426 10:16644086-16644108 TAAGGTGGGCAGAGGGTGGTGGG + Intronic
1065658778 10:27983012-27983034 AAAGGCTGGCAGAGGGAGGAGGG + Intronic
1067018677 10:42776272-42776294 AAATGGAGGCAGAGGATGGAAGG - Intergenic
1067244858 10:44531462-44531484 AAAGGTAGTAAGAAGGAGGGTGG + Intergenic
1067905106 10:50282380-50282402 CAAGGTATTCAGCTGGTGGATGG - Intergenic
1068854288 10:61781801-61781823 AAAGGTAGCTAGATGGAGGATGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071089581 10:81902744-81902766 ACAGGTAGCCACAGGGTGCAGGG + Intronic
1071563636 10:86660656-86660678 AGAGCTAGGCAGAGGGTGCAAGG + Intronic
1072444573 10:95487519-95487541 AAAGGCAGTCAGACGGAGGAAGG + Intronic
1072806630 10:98427545-98427567 AATGGTGGTCAGGGGGTAGAGGG + Intronic
1073241858 10:102064472-102064494 AAAGGCAGTCAAGGGGTGGAAGG + Intergenic
1073441084 10:103553096-103553118 AAAGGCAGGCAGGGTGTGGAGGG + Intronic
1073496475 10:103896089-103896111 AAAGGGAGTGAGAGGGAGGATGG + Intronic
1074283091 10:112071561-112071583 GAAGGTTGTCAGAGTGGGGAGGG - Intergenic
1074938965 10:118216210-118216232 TAAGGAAGTCAGGGGGAGGAGGG - Intergenic
1075284206 10:121169025-121169047 AAAGGCAGGTAGAGGGTGAAAGG + Intergenic
1075692928 10:124412042-124412064 AAATGTCATCAGAGGTTGGAGGG + Exonic
1076510241 10:131008291-131008313 AAAGGTAGTCATAGGGTGTGGGG + Intergenic
1076776623 10:132701468-132701490 AAATGGAGGCAGAGGGTGTATGG - Intronic
1077159513 11:1106311-1106333 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159524 11:1106357-1106379 GATGGTAGACAGATGGTGGATGG - Intergenic
1077756177 11:5030190-5030212 AAAGGTAGAGTGAGGGAGGAGGG - Intergenic
1078053932 11:7991714-7991736 AAAAGTAGTCAGAGGTTGTTGGG + Intronic
1078143207 11:8706397-8706419 AATGCTGGTCAGAGGGTTGATGG - Intronic
1078708089 11:13764424-13764446 AGAGTTAGTGAGAGTGTGGATGG - Intergenic
1078859771 11:15236279-15236301 TAAGGTAGTCTCAGGGTGGGGGG + Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079395774 11:20062074-20062096 AAAAGTATTCAGAAGGTTGAAGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080822975 11:35824662-35824684 AAAGGATGTCAGGGGTTGGAGGG - Intergenic
1081547690 11:44083408-44083430 GCAGGTACTGAGAGGGTGGAAGG - Exonic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082778746 11:57269752-57269774 AAAGGCAGACAGAGGCTGGAAGG - Intergenic
1083309068 11:61775333-61775355 AAAGGGAGCCACAGGGTGGAGGG - Intronic
1084666447 11:70578972-70578994 ACAGCTGGGCAGAGGGTGGATGG - Intronic
1085786984 11:79461450-79461472 AAATGTAATCAGAGAGGGGAGGG - Intergenic
1086668983 11:89523425-89523447 TAAAGTAGTCTGAGGGTGAAAGG + Intergenic
1087001948 11:93430136-93430158 AACAGTAGCCAGAGGGTGGCAGG - Intronic
1087151508 11:94864354-94864376 TAATGTAGTCAGAAGGGGGAGGG + Intronic
1088816596 11:113425383-113425405 AGAGGTAGACAGCAGGTGGAGGG + Intronic
1088907868 11:114168636-114168658 AAAGCAAGACACAGGGTGGAAGG - Intronic
1089669614 11:120044642-120044664 AGAGGTTGGCAGAGGTTGGAGGG - Intergenic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1091441320 12:513096-513118 GAAGGAAGGCAGAAGGTGGAAGG - Intronic
1091776335 12:3187363-3187385 AAAGGCAGGCAGAGGAAGGAAGG - Intronic
1092148661 12:6232224-6232246 GAAGTTAGCCAGAGTGTGGAAGG + Intronic
1092299736 12:7235443-7235465 TAATAAAGTCAGAGGGTGGAAGG + Intergenic
1093250715 12:16801180-16801202 AAAAGTAGTCAGAGTGAGGGGGG - Intergenic
1093698177 12:22186752-22186774 AAAAGAAGTTAGAGGGTGAAAGG + Intronic
1094226427 12:28051274-28051296 ATAGGTAGTCAGAGGCTGAGTGG - Intergenic
1095680326 12:44967231-44967253 AAGGGTAGTGGGAGGGGGGAGGG + Intergenic
1095886677 12:47195501-47195523 AAAGATAATCAGAGGAAGGAGGG - Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096901909 12:54892023-54892045 AAAGGTAGTCAGAATATGGGAGG - Intergenic
1097770448 12:63578312-63578334 AAGGATAGTGAGGGGGTGGAGGG + Intronic
1098618732 12:72564207-72564229 AAAGGTGGTGAGAGTGTGGCAGG - Intronic
1098644480 12:72881272-72881294 AGAGGCTGTAAGAGGGTGGAGGG - Intergenic
1098726362 12:73972788-73972810 GAAGCCAGTCAGGGGGTGGAGGG + Intergenic
1099431592 12:82592477-82592499 AGAGGTGGTCAGAGGGTGGCTGG - Intergenic
1099945597 12:89240225-89240247 AAGGGTAGTCAGGAGTTGGAGGG - Intergenic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1102483819 12:113242765-113242787 GGAGGTATTCACAGGGTGGATGG - Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1103794378 12:123493408-123493430 AAAGGAACTCAGAGGCTGGCGGG + Intronic
1104737252 12:131143232-131143254 GAAGGAAGTCAGAGGGCGGCAGG - Intergenic
1105510544 13:21048500-21048522 TATGGTAGGTAGAGGGTGGATGG - Intronic
1109201707 13:59438583-59438605 AATGGTAGTCAAAATGTGGAAGG - Intergenic
1109436203 13:62306700-62306722 TAAGGTAGTCAGATGGGGAATGG - Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1110694387 13:78471266-78471288 GGAGGGAGTCAGAGGCTGGATGG - Intergenic
1113350731 13:109526657-109526679 AAAGGTAGACACAGTGTGGGTGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113542296 13:111118252-111118274 AGAGTTAGGAAGAGGGTGGAGGG + Intronic
1113881828 13:113631204-113631226 AAAGGAAGTAAAAGGGTGAAGGG + Intronic
1115708168 14:36019567-36019589 TATGGTACTCAGAGGGAGGATGG + Intergenic
1116569098 14:46492247-46492269 TGAGGTACTCAGATGGTGGAGGG - Intergenic
1117255358 14:53971664-53971686 GAAGGGTGTCATAGGGTGGAAGG - Intergenic
1119065634 14:71523422-71523444 AAAGGTGGGCAAAGGGTAGATGG - Intronic
1119731087 14:76951481-76951503 AAAGGAAGTAAGAGGGTGTATGG - Intergenic
1120447042 14:84612160-84612182 AAAGGCAGTAAGAGTGTGGTTGG - Intergenic
1120507130 14:85366613-85366635 AATTGTAGTCAGAGACTGGAGGG - Intergenic
1120837003 14:89048802-89048824 AAAGGCAGACAAAGAGTGGAAGG + Intergenic
1121240996 14:92430135-92430157 AAAGTTACTCAGAAGGTGGAAGG - Intronic
1121447113 14:93986054-93986076 AGAGGCACTCAGAGTGTGGAAGG - Intergenic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122655001 14:103252458-103252480 AAGGGTAGTGGGAGGGTGAAGGG + Intergenic
1124572684 15:30880229-30880251 AAGTGTAGTGAGAGGGTGAAGGG - Intergenic
1126904879 15:53353934-53353956 AAAGGTAGTGGGGGGGTGGGAGG - Intergenic
1128896603 15:71379388-71379410 TAATGGAGTCAGAGGTTGGAAGG - Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1129888001 15:79052144-79052166 AAAGCCAGTCTGAGGGTGGTGGG - Intronic
1130024400 15:80259044-80259066 ATAGGTAGCCAGAGGATGGAGGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1134552652 16:15145161-15145183 CAAGGTAGGAAGAGGGTGGTGGG + Intergenic
1135551232 16:23399706-23399728 AGAGGCAGACAGAGGCTGGAGGG + Intronic
1135754362 16:25083999-25084021 AAAGTGAGACAGAGGGTGTAGGG + Intergenic
1135859196 16:26039723-26039745 AAGGGTAGTGAAAGGGTGGGGGG - Intronic
1136568235 16:31082405-31082427 AAAGGTGTGCAGAGGGTGGCAGG - Intronic
1136934581 16:34448135-34448157 AAGGGTAGTGAGAGGGTGGGGGG + Intergenic
1136969991 16:34963679-34963701 AAGGGTAGTGAGAGGGTGGGGGG - Intergenic
1138235772 16:55381205-55381227 AAAGTTATTCAGAAAGTGGATGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138985212 16:62320223-62320245 AAGGGTAGTGAGAGGGTTGGGGG - Intergenic
1140083953 16:71777409-71777431 AATGGTAGAGTGAGGGTGGAGGG + Intronic
1140314108 16:73877228-73877250 AAATGTATTCAGAGGGTTCAAGG - Intergenic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1141812489 16:86384892-86384914 AGAGCCTGTCAGAGGGTGGAAGG - Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1142150558 16:88510786-88510808 AAGGGTAGGCAGTGGGTGGGTGG - Intronic
1143280807 17:5752789-5752811 AAAGGGAGTGAGAGAGTGCAAGG - Intergenic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143663045 17:8339064-8339086 AAAGGGAGGCAGAAGCTGGAGGG + Intergenic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1144518881 17:15941229-15941251 AGAGGTAGTCAGATGGCAGATGG + Intergenic
1145883675 17:28368853-28368875 AAGGGTACTCAGGGGGTGGTGGG - Exonic
1146136066 17:30322118-30322140 AAAGGTAGTTACAGGCTGGGTGG - Intronic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1150534503 17:66021686-66021708 AGAGGTAGTCAGCAGGTGGCTGG - Intronic
1151027752 17:70699123-70699145 AAAAGTAGTCTGAGGCTTGAGGG + Intergenic
1151352040 17:73537518-73537540 AGAGGCAGGCAGAGGGTGGAAGG + Intronic
1152366569 17:79860006-79860028 AAAGGAGGTCAGAGGCGGGATGG + Intergenic
1153388266 18:4525069-4525091 AAGGGTAGTGATAGGTTGGAAGG - Intergenic
1154083668 18:11281353-11281375 AGAGGTGGTCAGAGGGTGTTGGG + Intergenic
1154282033 18:13012127-13012149 ATTGGTTGTCAGAGGCTGGAAGG + Intronic
1155597830 18:27509103-27509125 AATGGTAGTGGGAGGGTGAAGGG + Intergenic
1156363291 18:36403240-36403262 AAAGGTGGGTAGAGGGAGGAGGG - Intronic
1157095398 18:44681661-44681683 AGAGGTATTGAGAGTGTGGAAGG + Intronic
1158288898 18:55916886-55916908 ACAGCTGGTCAGAGGGTGGAAGG + Intergenic
1158321517 18:56269108-56269130 ACAGGGAGTCAGAGGTTGGGAGG + Intergenic
1160221332 18:76980088-76980110 AAAGAAAGTCCAAGGGTGGAGGG + Intronic
1161517696 19:4705682-4705704 ACAGGTGGTCAGGGGGAGGAGGG + Intronic
1162225728 19:9220688-9220710 AAACGAAGTCAGTGTGTGGAAGG - Intergenic
1163347744 19:16754588-16754610 AAAGGAAGACAGATGATGGATGG - Intronic
1164124025 19:22293788-22293810 AAAGGTAGACAAAAGGTGGCTGG - Intronic
1165392841 19:35548263-35548285 CAAGGAAGGCTGAGGGTGGAGGG - Intergenic
1165825809 19:38705151-38705173 AGGGGTAGTCAGTGGGTGGCAGG + Intronic
1165952106 19:39480274-39480296 AAGGGAACTCAGAGGCTGGAGGG + Intergenic
1166102238 19:40577527-40577549 AAAGGGGGGCAGAGGATGGATGG - Intronic
1166648073 19:44547562-44547584 AAAGTTTGTCAGAGGAAGGAAGG + Intergenic
1167571180 19:50290117-50290139 GAAGGGAGTCACTGGGTGGATGG - Intronic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
1168542683 19:57226191-57226213 AAAAGGAGTGAGAGGGTGCAGGG - Intergenic
925171319 2:1751898-1751920 TGATGAAGTCAGAGGGTGGAAGG + Intergenic
925680682 2:6418134-6418156 AAAAGGAGTCAGAGGGGGAAGGG - Intergenic
926519279 2:13889976-13889998 AAGGGTAGTTGGATGGTGGAGGG + Intergenic
927042130 2:19240368-19240390 GCAGGCAGTCAGAGGGAGGAGGG - Intergenic
927411337 2:22829674-22829696 CAAGGTAGTAACAGGGTGGTGGG - Intergenic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
929846071 2:45529298-45529320 AAATGTAGTCAGAAGGAAGATGG + Intronic
930237611 2:48903000-48903022 AAAGGTAGTGGGGGAGTGGAGGG - Intergenic
930303376 2:49646078-49646100 AAAGGGGGTTAGAAGGTGGAGGG - Intergenic
930849790 2:55947688-55947710 CAAGGCAGTTAGAGGTTGGATGG + Intergenic
932742904 2:74305692-74305714 AAAGGGAGTTGGAGGGAGGAAGG - Intronic
933326075 2:80839116-80839138 AAGGGTAGTGAGAGGGTTGTTGG - Intergenic
933598150 2:84303346-84303368 AGAGGTACTCACAGGGTTGAAGG + Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934986016 2:98885032-98885054 GAAGGTAGCAAGAGGGTGCAGGG + Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
937843459 2:126551678-126551700 GCAGGACGTCAGAGGGTGGAAGG - Intergenic
938219432 2:129552944-129552966 AAAGGTATTTAGGGGGTAGAGGG - Intergenic
939946683 2:148419718-148419740 AAAGGTAGGTAGAGGGTGGCTGG - Intronic
940041470 2:149366164-149366186 AAAGGCAGGCAGTGGGTGAAAGG - Intronic
941963499 2:171276954-171276976 AATGGTAGTCAGAGGCGGGGTGG + Intergenic
942130057 2:172869601-172869623 AAATGCAGTGAGAGGGTGGATGG - Intronic
945838849 2:214864818-214864840 AAGGGTAGTTGGAGGGTGGGGGG + Intergenic
947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG + Intergenic
948847149 2:240688509-240688531 ACAGGTAGGCAGAGGGTTCAGGG + Intergenic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
1170465751 20:16621141-16621163 ACAGGTAGCCTGAGGGAGGATGG - Intergenic
1170655856 20:18287643-18287665 AAGGGCAGTGAGAGGGTGCACGG + Intergenic
1170963817 20:21049038-21049060 AAAGGCACTGGGAGGGTGGAGGG + Intergenic
1171089978 20:22275806-22275828 GAAGGAAGTCACAGGGTAGAAGG + Intergenic
1171276520 20:23860741-23860763 AAGGGAACTCAGAGGCTGGAGGG - Intergenic
1171973885 20:31581582-31581604 GAAGGGAGTGAGGGGGTGGAGGG + Intergenic
1172231153 20:33337073-33337095 AAAGGAAGGCTGAAGGTGGAGGG + Intergenic
1172371576 20:34396981-34397003 ATATGTAGACAGAGGGTGAAGGG - Intronic
1172408752 20:34707263-34707285 AAAGGGGGTCAGAGGGGGGAGGG + Intronic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174533320 20:51231764-51231786 GAAGGTGCTCAGAGGATGGAAGG + Intergenic
1174708028 20:52676842-52676864 AAAGAAGGTCAGAGGGTGGGAGG + Intergenic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1175185093 20:57174568-57174590 AAATGAAGTCAGAGGGCAGAGGG + Intronic
1175775708 20:61652267-61652289 CAAAGGAGTAAGAGGGTGGAAGG - Intronic
1175817832 20:61892895-61892917 AAAGGTAGAAAGAGGGAGGGAGG + Intronic
1177106367 21:16960850-16960872 AAAGGTAGTTGGAGGTTGGGGGG - Intergenic
1177873547 21:26602857-26602879 AAGGGTAGTCAGAGAGGGAAGGG - Intergenic
1178177733 21:30123732-30123754 AAGGGTAGTGGGAGGCTGGAGGG - Intergenic
1178660740 21:34505506-34505528 AAAGAGAGGCAGAGGCTGGAGGG + Intergenic
1179628531 21:42662344-42662366 ACAGGTAGGGGGAGGGTGGATGG - Intronic
1181387973 22:22558550-22558572 AAAGAAAGTCAGAAGGTGGGGGG + Intronic
1182196401 22:28522848-28522870 AGTGGTTGTCAGAGGCTGGAAGG + Intronic
1184950645 22:47840364-47840386 AAAGGAAGTCAGGAGGAGGAAGG - Intergenic
1185101838 22:48844752-48844774 AAAGGAAGAGAGAGGCTGGAGGG - Intronic
949416154 3:3816462-3816484 AAAAGTGGACTGAGGGTGGAGGG - Intronic
950694831 3:14690822-14690844 GAAGGTGGTGGGAGGGTGGATGG + Intronic
952001546 3:28791446-28791468 AAAGGTAGACAGAGCTTGTAGGG - Intergenic
952474048 3:33686958-33686980 AAAAGAAGAGAGAGGGTGGAGGG - Intronic
952991670 3:38836077-38836099 AAAGGAAGGCAGTGGGTGGCTGG - Intergenic
953283072 3:41577603-41577625 AAGGGTAGTGGGAGGTTGGAGGG - Intronic
953455826 3:43041623-43041645 AGATGAAGTCAGAAGGTGGATGG - Intronic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
955577865 3:60386229-60386251 AGTGGTAGTCAGTGGGTGGGAGG - Intronic
956829438 3:73031043-73031065 AGAGGTTGTCAGAGGGTTGAGGG + Intronic
957768469 3:84657725-84657747 AGAGGTTGGAAGAGGGTGGAGGG + Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961826612 3:129602453-129602475 AAAGGGAGAATGAGGGTGGAGGG - Intronic
962786614 3:138774281-138774303 AAAAGAAGTCAGATGGTGGTAGG - Intronic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
963817132 3:149843972-149843994 AAAGGGAGACAGAGTTTGGAGGG - Intronic
964308425 3:155365090-155365112 ACAGGTAATCAGAAGGTTGATGG + Intergenic
965106288 3:164359461-164359483 AAATGTAGTCATAGGTTGGAGGG - Intergenic
965693651 3:171383939-171383961 AAAGGGAGGCTGAGGTTGGATGG - Intronic
966890991 3:184407529-184407551 AAATGTACTCAGATGATGGAGGG + Intronic
966929322 3:184665543-184665565 AAAGGCAGACAGAGAGTTGAGGG - Intronic
967415316 3:189210895-189210917 AAGGGTAGTCATTGAGTGGAGGG + Intronic
967878072 3:194280197-194280219 AGAGGGACTTAGAGGGTGGAGGG + Intergenic
968110948 3:196046305-196046327 AAAGGTAGGCAAACAGTGGAGGG - Intronic
969089187 4:4680482-4680504 AAAGGCTATCAGAGGGCGGATGG + Intergenic
970985692 4:22154454-22154476 AAGGGTAGCTAGAGGGTGCAAGG + Intergenic
972005004 4:34090823-34090845 AAAGTTAGTCACGGAGTGGAAGG - Intergenic
972129995 4:35820785-35820807 AAAGGTGGGCAGAGGGGGAAGGG - Intergenic
972148591 4:36061344-36061366 AAGGGTAGTGAGAGGGTGGTGGG - Intronic
973299528 4:48564533-48564555 TAAGGAAGGCAGAGTGTGGAGGG + Intronic
975035679 4:69677313-69677335 AATGGTAGTGAGGGGCTGGAGGG + Intergenic
975343337 4:73265791-73265813 AAGGGTAGTAAGAGGGTGAAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976898555 4:90142698-90142720 GAAGGTAGCCAGAGGCTGCAGGG - Intronic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
977459724 4:97310127-97310149 AGAGGTAGTCAGAGGGTAACGGG - Intronic
977604865 4:98973806-98973828 AATGGTAGTGAGAGGCTGGATGG - Intergenic
977875902 4:102149589-102149611 AAAGGTAGTGGGAGAGTGGCGGG - Intergenic
978277361 4:106967985-106968007 AAAGGTAGTAAGAGAGGAGATGG + Intronic
980687106 4:136242593-136242615 AAGGGTAGTGAGAGGCTGGTGGG + Intergenic
981051797 4:140316592-140316614 AAAGGGAGTGAGTGTGTGGAGGG + Intronic
981634023 4:146854560-146854582 AAAGGGAGTAAGAGTGAGGACGG - Intronic
981739617 4:147988463-147988485 AAAGGCTGTCAGATGGAGGAGGG - Intronic
981944801 4:150328733-150328755 GAGGGCAGTCAGAGGGTGGGTGG + Intronic
982370288 4:154626732-154626754 AAACCTAGTCGGAGGGTGGCTGG - Intergenic
983166418 4:164482345-164482367 ACAGGGAGTCAGAGGGAGGGTGG + Intergenic
984886485 4:184454572-184454594 AATGGTAGCCAGAGGTGGGAGGG + Intronic
985616991 5:928734-928756 AAAGGTTGGAAGAGTGTGGAGGG + Intergenic
986285284 5:6354430-6354452 AGAGGGAGGCAGAGGCTGGAGGG + Intergenic
987202682 5:15593173-15593195 AGAGGAAGTGAGAGGGAGGAAGG - Intronic
987773814 5:22338426-22338448 AAGGGTACTGAGAGGGTGGTGGG + Intronic
988818310 5:34855869-34855891 AAAGTTACTTAGAGGGTGGTTGG + Intronic
990364619 5:55057721-55057743 AGTGGGAGACAGAGGGTGGACGG + Intergenic
990504822 5:56433823-56433845 AAAGGAACTGAGAGGGAGGATGG + Intergenic
990705845 5:58528563-58528585 AGAGTGAGTGAGAGGGTGGAAGG + Intergenic
994660524 5:102648401-102648423 AAGGGTAGTGGGAGGGTGAAGGG + Intergenic
995559717 5:113367613-113367635 TAAGGAAGGCAGAGGGTGGGGGG + Intronic
996557138 5:124790067-124790089 GAAGGGAGCCAGAGGGTGGACGG - Intergenic
999045307 5:148461185-148461207 AAAGGTAGAAAAAGGGTAGAAGG + Intronic
999474247 5:151883909-151883931 AAAGGTAGTCAGAAGATGTGGGG + Intronic
999897803 5:156053413-156053435 AAAGGTAGTGAGGGGGTGAGAGG + Intronic
1000319734 5:160124703-160124725 ATAGGTAGTCAGAGGATGACTGG - Intergenic
1000454701 5:161435608-161435630 AAAGGAAGTGAGAGGGAAGAGGG + Intronic
1000549327 5:162640034-162640056 GAAGGTAGTCGGGGGCTGGAAGG - Intergenic
1001341135 5:170846611-170846633 AAAGGAAGTTGGGGGGTGGAGGG - Intergenic
1001736901 5:174012950-174012972 AAAGGTATTTACAGGTTGGAAGG - Intergenic
1002134626 5:177100000-177100022 AAAGGAAGACAGAGAGGGGAGGG - Intergenic
1002506203 5:179680843-179680865 ATAGGTGGACAGAGGCTGGATGG + Intronic
1004304683 6:14488882-14488904 AAAGCTATTCGGAGGGAGGAGGG + Intergenic
1005713949 6:28529125-28529147 AAAGATACTAGGAGGGTGGAAGG - Intronic
1005818163 6:29574376-29574398 AAAGGCAGGCGCAGGGTGGATGG - Intronic
1005953149 6:30646140-30646162 GAAGGGAGTCAGATGGTGGTGGG - Intronic
1006811134 6:36821295-36821317 AAAGGAAGTCACAAGGTGGGGGG + Intronic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1007107619 6:39294562-39294584 AGAGAAAGTCAGAGAGTGGATGG + Intergenic
1007286728 6:40753253-40753275 AAAGGTGGGGAGAGGGTGGCTGG - Intergenic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007505425 6:42331834-42331856 AAAGGGAGGCTGGGGGTGGAAGG - Intronic
1010032501 6:71286257-71286279 AAAGGTATTCAGATGGTGGATGG + Intergenic
1010131347 6:72497364-72497386 AACTGGAGTCGGAGGGTGGAGGG - Intergenic
1010257471 6:73775673-73775695 AGAGATTGTCAGAGGGTGGAGGG - Intronic
1011600639 6:89056970-89056992 AAAGGTTGTCTGGGGGAGGAGGG - Intergenic
1012282926 6:97350551-97350573 AAAGTTTTTCAGAGGGTAGAAGG - Intergenic
1012296152 6:97527012-97527034 AAAGGAAGTCAGTTGTTGGAAGG + Intergenic
1014827604 6:126064188-126064210 AAAGGTGGGCATGGGGTGGAGGG + Intergenic
1015235095 6:130961863-130961885 AATGGTAGCAAGAGGATGGAGGG + Intronic
1015692107 6:135936989-135937011 GAAGGGAGTCAGAGTGAGGAGGG + Intronic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1016697675 6:147016824-147016846 AAAGGTGGTAAGTGGGTGGATGG + Intergenic
1016774274 6:147887354-147887376 AAAGCAAATCAGAGGTTGGATGG - Intergenic
1017297133 6:152811155-152811177 AATGGTTGTCAGGGGTTGGAGGG - Intergenic
1017444450 6:154494689-154494711 AGAGGGTGGCAGAGGGTGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017579163 6:155841907-155841929 AAAGCAAGTCAGAGGGAGGAAGG + Intergenic
1018208389 6:161456743-161456765 ATGGGTGGTCAGAGGGTGAAAGG + Intronic
1018330090 6:162718245-162718267 AAAGTCAGTCAGAGAGGGGATGG - Intronic
1018575880 6:165259579-165259601 AGAGGTAGGAAGAGTGTGGAGGG - Intergenic
1019226356 6:170513322-170513344 AAAGCTAGGGAGAGAGTGGAAGG + Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1021532601 7:21665112-21665134 AAAGGCACTGAGAGGGAGGAAGG - Intronic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1022929926 7:35100562-35100584 AAGGATAGTGAGGGGGTGGAGGG + Intergenic
1023326342 7:39062413-39062435 AAAGGTAAGAAGTGGGTGGAAGG - Intronic
1023486006 7:40687538-40687560 AAAGGAACACAGAGGTTGGAGGG - Intronic
1023537280 7:41226600-41226622 AAAGGGAGTGAAAAGGTGGATGG + Intergenic
1026159946 7:67859952-67859974 AAAGGTAGGAAAAGGGTGAAGGG - Intergenic
1026630696 7:72035208-72035230 AAAAGAATTCAGAGGATGGATGG - Intronic
1027345801 7:77258234-77258256 AATGGGAGCCAGGGGGTGGAGGG - Intronic
1028598813 7:92578476-92578498 AGAGGTATTAAGAGGATGGAGGG - Intronic
1029551899 7:101240980-101241002 AGAGGCATTCAGAGAGTGGAAGG - Intronic
1029825820 7:103193006-103193028 AAGGATAGTGAGGGGGTGGAGGG + Intergenic
1030328773 7:108250600-108250622 AATGGTAGTGGGAGGGTGGTTGG + Intronic
1030840462 7:114346764-114346786 AAAGGTTATCAGAGACTGGATGG + Intronic
1031706651 7:124988835-124988857 AAAGGGAGTCAGAGGGTAAGAGG + Intergenic
1032685153 7:134225239-134225261 AAAGGCAGTGTGAGAGTGGAAGG + Intronic
1034307108 7:150052862-150052884 AAAGGTAGTTAGAAAGTGGGAGG - Intergenic
1034639925 7:152594454-152594476 AAAGGTACCCAGAGGGTGATGGG - Intergenic
1034799740 7:154047820-154047842 AAAGGTAGTTAGAAAGTGGGAGG + Intronic
1035309450 7:157955926-157955948 AAAGAGAGTCAGAGGTTGGAAGG + Intronic
1035789736 8:2293347-2293369 AAAGGTTGGCAGAGGCTGCAAGG + Intergenic
1035803069 8:2428358-2428380 AAAGGTTGGCAGAGGCTGCAAGG - Intergenic
1036037269 8:5032575-5032597 GAAGGAAGGGAGAGGGTGGAGGG + Intergenic
1036389931 8:8316632-8316654 ACATGTAGTCAGGGGCTGGAAGG + Intergenic
1037411576 8:18604096-18604118 AGAGGTTGGAAGAGGGTGGAGGG + Intronic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037773997 8:21820662-21820684 AAAGGTAGTAAGAGGGGGTTGGG + Intergenic
1038852863 8:31297107-31297129 AAAAGAAATCTGAGGGTGGAAGG + Intergenic
1039093821 8:33861280-33861302 AAAGGAATTGGGAGGGTGGAGGG - Intergenic
1039366820 8:36936837-36936859 AAAGGTAGAAGGGGGGTGGAGGG + Intergenic
1040690960 8:49937872-49937894 AAAGGAACTCAGAAGGAGGAGGG - Intronic
1040857587 8:51964531-51964553 AAAGGTTGCCAGAGGCTGGCAGG - Intergenic
1040907642 8:52485585-52485607 GGAGGCAGTGAGAGGGTGGATGG - Intergenic
1044667668 8:94647604-94647626 AATGATGGTCAAAGGGTGGAGGG - Intronic
1045455379 8:102373477-102373499 ACAGGTATTCAGAATGTGGATGG - Intronic
1046446711 8:114330224-114330246 AAAGGTAGTGGGTGGGTGGAAGG - Intergenic
1046827925 8:118712074-118712096 AAAGGCAGCCAGAGAATGGATGG + Intergenic
1047828995 8:128611407-128611429 TAAGGTAACCAGAGGGTGTATGG + Intergenic
1048457062 8:134587775-134587797 GAAGGAATTCAGAAGGTGGAAGG - Intronic
1048798790 8:138176850-138176872 CAAGGCAGTGAGAGGGTTGAGGG - Intronic
1048935933 8:139357074-139357096 AAAGGAGGTAAGAGGGTGGAAGG + Intergenic
1051941443 9:22510146-22510168 AATGGTAGTGAGAAGGTAGAGGG + Intergenic
1052280149 9:26723692-26723714 AAGGGAAGCCGGAGGGTGGAAGG + Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1054793099 9:69274142-69274164 CGAGGAAGTCAGAGGGAGGAAGG - Intergenic
1055575935 9:77660330-77660352 AAGGGAAGGAAGAGGGTGGAGGG - Intergenic
1056153572 9:83813432-83813454 AAAGGAACTCAAAGGGAGGAGGG - Intronic
1056285207 9:85080521-85080543 AAAGATGTTCAGAGAGTGGATGG + Intergenic
1058229418 9:102407538-102407560 AAAGGTAGGGGGAGGGGGGAGGG + Intergenic
1058546779 9:106069071-106069093 TAATGTAGTCAGAGGCTGGTCGG - Intergenic
1059752272 9:117259082-117259104 AGAGGTACTGGGAGGGTGGAAGG - Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1190176610 X:48155815-48155837 AAATGTAATCAGAGGTTGGAGGG + Intergenic
1190181618 X:48197325-48197347 AACTGTAATCAGAGGTTGGAGGG - Intronic
1190191298 X:48279528-48279550 AAATGTAAGCAGAGGTTGGAGGG - Intergenic
1190194640 X:48306706-48306728 AAATGTAATCAGCGGTTGGAGGG - Intergenic
1190200557 X:48357229-48357251 AAATGTAAGCAGAGGTTGGAGGG - Intergenic
1190211070 X:48448420-48448442 AAATGTAGTCAGAGGTTGGAGGG + Intergenic
1190618912 X:52265759-52265781 GCAGGTAGTGAGAGGGAGGAAGG + Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190661135 X:52655311-52655333 AAATGTAATCAGAGGTTGGAGGG - Intronic
1191163140 X:57356941-57356963 AGGGCTTGTCAGAGGGTGGAGGG - Intronic
1192154000 X:68729848-68729870 AAGGGTAGTAAGGGGGTGGGTGG + Intergenic
1192604731 X:72504340-72504362 ACTGGTTGTCAGAGGCTGGAAGG - Intronic
1192903931 X:75529474-75529496 TGAGGTAGTGGGAGGGTGGAGGG - Intergenic
1194202395 X:90969598-90969620 AAGGGTAGTGGGAGGGTGGAGGG + Intergenic
1194313000 X:92338015-92338037 AAGGGTAGTGAGAGGGTTGGGGG + Intronic
1194394670 X:93367599-93367621 AAAGGTAGTTGGGGGGTGGGGGG - Intergenic
1195502310 X:105615685-105615707 AAACGTAGTGAGGGGTTGGAGGG + Intronic
1195751860 X:108167896-108167918 AAGGGAAGGAAGAGGGTGGAGGG - Intronic
1195819703 X:108930795-108930817 AAGGGTAGTGACAGGTTGGAAGG - Intergenic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196069980 X:111509668-111509690 AAAGGGAGTCAGATTGTGAAAGG - Intergenic
1196308328 X:114130410-114130432 AAAGGTAGTGGGAGGATTGAGGG - Intergenic
1196322447 X:114357332-114357354 AAGGGTAGTCAGTGGCTGGGAGG + Intergenic
1196996027 X:121384976-121384998 AAGGGTAGTAAGGGGCTGGAGGG + Intergenic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197487272 X:127068707-127068729 AAGGGTAGTCAGGGGTTGGGGGG - Intergenic
1197520021 X:127485981-127486003 ATATGCAGTCAGTGGGTGGAGGG - Intergenic
1197523980 X:127538765-127538787 AAAGATAGTGAGGGGGTGGAAGG - Intergenic
1197862043 X:130981135-130981157 AAGGGTAGTGAGAGGGTGGAGGG + Intergenic
1198251770 X:134885963-134885985 AAAGGAAGTTAGGGGGTGGGAGG - Intergenic
1198585904 X:138122020-138122042 AAGGGTAGTTGGAAGGTGGAAGG - Intergenic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1199207705 X:145168039-145168061 AAAGGTAATTAGAGGCTGGCAGG - Intergenic
1199429741 X:147745723-147745745 AAAGCTAGTCAGAAAGAGGATGG - Intergenic
1199660256 X:150042360-150042382 AAGGGTAGTAAAAGGGTGGGTGG - Intergenic