ID: 929101172

View in Genome Browser
Species Human (GRCh38)
Location 2:38315572-38315594
Sequence GTATACTCATGGCCTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929101172 Original CRISPR GTATACTCATGGCCTAAAAG TGG Intronic
905187487 1:36207086-36207108 TTATACTCAGGGCTTCAAAGGGG - Intergenic
905621729 1:39454312-39454334 GCATACTCAAGGCCTATAATTGG - Intronic
909534441 1:76720371-76720393 GTATACTAATGTTCTAAAATTGG - Intergenic
909543665 1:76819176-76819198 GCATAGTCATAGGCTAAAAGTGG - Intergenic
913181611 1:116327885-116327907 CTATAGTCATGGTCTCAAAGAGG + Intergenic
917863646 1:179172754-179172776 AAATACATATGGCCTAAAAGTGG + Intronic
918742826 1:188157483-188157505 TTATACTCATGTCTTAAAAATGG + Intergenic
918792325 1:188844794-188844816 GAATACTCAAGACTTAAAAGTGG + Intergenic
1071091804 10:81927753-81927775 GAATACTCATGGCCAAGAGGGGG - Intronic
1071831404 10:89375789-89375811 GTATACTCAAGGAATAAAATGGG + Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084931472 11:72559986-72560008 GTATATTCATTGACTGAAAGTGG - Intergenic
1087065724 11:94026311-94026333 GGATACTCATAGCCACAAAGAGG + Intronic
1088787449 11:113195022-113195044 GTATCCTCATGGCTTAAAGCTGG - Intronic
1091862898 12:3802697-3802719 GTTTACTCATGGCCCCACAGAGG + Intronic
1096120884 12:49088913-49088935 GCATAGTCATGGCCTGAAAAAGG - Intergenic
1099733270 12:86533747-86533769 GAATACCCTTGGCCTAAAGGGGG - Intronic
1101125614 12:101630673-101630695 TTATACTCAGTGCCTAAAACAGG - Intronic
1102808655 12:115804589-115804611 GTATACTCAGGGCTTCAAAATGG - Intergenic
1103187702 12:118975326-118975348 GTATACCCATGGCTCAAAGGAGG + Intergenic
1106935897 13:34719395-34719417 GTATAATTATGTCCTAATAGAGG + Intergenic
1108298880 13:49054161-49054183 GGGTCCTCTTGGCCTAAAAGAGG + Intronic
1108681561 13:52785076-52785098 ATAGACTCATGGCCTCAAATGGG + Intergenic
1109090825 13:58042919-58042941 GTATACCCATGTCCTTAAAACGG - Intergenic
1115246057 14:31296898-31296920 GTATTCTCTGTGCCTAAAAGAGG - Intronic
1116649409 14:47570435-47570457 GTATACTCATGTGCAAAATGAGG + Intronic
1119049600 14:71353732-71353754 ATATACTCATGGCCTGGAACTGG + Intronic
1119277477 14:73371762-73371784 GTCTTCACATGGCCAAAAAGTGG - Intronic
1120390920 14:83907788-83907810 GTAAGAACATGGCCTAAAAGAGG - Intergenic
1127047841 15:55046092-55046114 GTATTCTCAATGCCTATAAGTGG - Intergenic
1137885879 16:52103140-52103162 GACTACTCATGGTCTGAAAGTGG - Intergenic
1144098721 17:11925005-11925027 GTATACAAGTGGCATAAAAGAGG - Intronic
1146607185 17:34270808-34270830 GAATGCTCAGAGCCTAAAAGGGG + Intronic
1151117389 17:71752655-71752677 GTATATTCATGGACAAGAAGTGG - Intergenic
1153993523 18:10420468-10420490 GGATTCTCATGGTCTAAAAAGGG + Intergenic
1157543176 18:48526821-48526843 GTTTACTCATGGTCACAAAGTGG - Intergenic
929101172 2:38315572-38315594 GTATACTCATGGCCTAAAAGTGG + Intronic
1173302327 20:41815183-41815205 GTATACTAATGGGCTATTAGTGG - Intergenic
1178146144 21:29742558-29742580 GTAAACATATGGACTAAAAGTGG + Intronic
949160080 3:870996-871018 GTTTACTCATGGTCCAAAATTGG - Intergenic
949722566 3:7007582-7007604 GTAGCCTCATGGCCTAAGATGGG + Intronic
955176239 3:56616581-56616603 GCATATTCATAGCCAAAAAGTGG - Intronic
956932882 3:74065462-74065484 ATACACTAATGGCCTAAAATAGG + Intergenic
964594667 3:158411299-158411321 GTATACTCTATACCTAAAAGTGG + Intronic
965485811 3:169277090-169277112 GTATCCTCATAATCTAAAAGAGG - Intronic
971577605 4:28295907-28295929 GTATATTTATGGGCTAAAAAGGG + Intergenic
975207716 4:71663692-71663714 GTACAATCAGGGCCTAGAAGTGG - Intergenic
976867998 4:89754063-89754085 GTATCCTCTTGGACTTAAAGGGG - Intronic
977025160 4:91809550-91809572 GAATACACATGGACAAAAAGTGG + Intergenic
979392209 4:120140863-120140885 GGATACTCACGGCCTTAAATGGG + Intergenic
981156638 4:141444854-141444876 GTATACTCATTGCTAATAAGAGG + Intergenic
984455045 4:179955415-179955437 GTTTAATCATGGATTAAAAGTGG - Intergenic
988488162 5:31684370-31684392 GTATACTGATGGCTTAGAAGTGG - Intronic
990075114 5:51835636-51835658 GTTTACTCAGCTCCTAAAAGGGG - Intergenic
990762961 5:59150839-59150861 ATCTACTGATGGCCTAAAATTGG + Intronic
990811201 5:59725495-59725517 GTATATTCATTGCCCAAAAAAGG + Intronic
993536072 5:89087907-89087929 GCATAATCCTGGCCTCAAAGTGG + Intergenic
994250113 5:97525952-97525974 TTATATTCATGGCTTGAAAGAGG + Intergenic
1008774150 6:55015282-55015304 GTATACTCATTGCCAGAAAATGG + Intergenic
1011011978 6:82713033-82713055 GAATTCTCATGACCTAAAGGGGG - Intergenic
1011675862 6:89732846-89732868 GCACACAAATGGCCTAAAAGGGG + Intronic
1013476082 6:110508564-110508586 GGATACTCATGGCCCTAAATGGG + Intergenic
1015768685 6:136746631-136746653 GTATAATCATGGTTTAACAGGGG + Intronic
1015973589 6:138767404-138767426 GTTTACTCTTGGCCTTAAAAAGG + Intronic
1016522819 6:144965714-144965736 GTATGATCATCGCCTATAAGGGG - Intergenic
1018338562 6:162823953-162823975 TTATTCTGTTGGCCTAAAAGGGG + Intronic
1019116680 6:169770292-169770314 GTATACTCATAGCAAAAATGTGG - Intronic
1020710997 7:11604978-11605000 ATACACACATGGCCTTAAAGTGG + Intronic
1027492265 7:78843296-78843318 GGATACTAATGGCATAAAATAGG - Intronic
1027564244 7:79769916-79769938 AGATACTAATGGCCTAAAAGTGG - Intergenic
1032653496 7:133903786-133903808 GTATACTCATGGCAAAGAAGAGG + Intronic
1034648531 7:152670551-152670573 ATATACTGATGCCCTAAAACAGG - Intronic
1035434018 7:158844414-158844436 GTTTACTCATTTCCTTAAAGGGG + Intergenic
1039237589 8:35519152-35519174 CTATACAAATGACCTAAAAGAGG - Intronic
1045841132 8:106582882-106582904 ATATATTCATATCCTAAAAGTGG - Intronic
1046662246 8:116960938-116960960 GGATACTCATTGCTTAAAATAGG - Intronic
1050886691 9:10775883-10775905 ATTTACTCATGGCATAAATGGGG + Intergenic
1053178805 9:35949866-35949888 GCATACTCAGGGTCCAAAAGAGG - Intergenic
1058414213 9:104768679-104768701 AGTTACTCATGGTCTAAAAGGGG - Intronic
1197815393 X:130493230-130493252 GTATAGTCATGGTCCAGAAGGGG + Intergenic
1198964633 X:142214690-142214712 GTATCATCTTGGCCAAAAAGAGG - Intergenic
1199287102 X:146065664-146065686 TAATACTCATGGCTGAAAAGGGG + Intergenic