ID: 929104743

View in Genome Browser
Species Human (GRCh38)
Location 2:38353761-38353783
Sequence TCACATCATCACTGAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929104743 Original CRISPR TCACATCATCACTGAAGCAC TGG Intronic
901354338 1:8630625-8630647 TGACAGCATCACTGGAGCCCTGG + Intronic
902657790 1:17881326-17881348 GCAGATCATCAGTGAAGCAGAGG - Intergenic
906345872 1:45014010-45014032 TCGCATCCTCACTGATGCTCTGG + Exonic
907320835 1:53601246-53601268 TCACAGCATCACTGGGGAACGGG - Intronic
913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG + Intergenic
917200374 1:172508362-172508384 TCACATCTTAGCTGAAGCCCGGG + Intergenic
919647613 1:200111059-200111081 ACCCATGGTCACTGAAGCACAGG - Intronic
920644513 1:207790092-207790114 TCTCATTCTCACTGAAGGACTGG - Intronic
922350427 1:224730624-224730646 TGACATCATCACTGGAGAGCAGG - Intronic
923453010 1:234137425-234137447 TCCCATGATCACTGATGCTCTGG - Intronic
1062861289 10:812411-812433 CCACATCAGCACTGATGCCCTGG + Exonic
1063371769 10:5526885-5526907 TGCCATCATCACTGCACCACTGG + Intergenic
1064158819 10:12925843-12925865 TCAGATCATCCCTTAAGCACAGG - Intronic
1068078747 10:52292000-52292022 ACTCATCATCACTGGATCACTGG - Intronic
1069419625 10:68235412-68235434 TCACACCATCATTTCAGCACAGG + Intergenic
1072776560 10:98202401-98202423 TAAGAGCATCACTGAAGGACAGG + Intronic
1073364134 10:102923643-102923665 GCACAACACCACAGAAGCACTGG - Intronic
1075635595 10:124028307-124028329 CCACATCATCACTTAGGAACAGG - Intronic
1077342922 11:2033985-2034007 CCACCTCATCACTGCAGCAGTGG - Intergenic
1080022098 11:27572892-27572914 TAAAATCATCCCTGAAACACAGG - Intergenic
1080313198 11:30918784-30918806 TCATTTCCTCACTGAATCACAGG - Intronic
1082220627 11:49631373-49631395 TCACTTCATCACTGCATCTCAGG + Intergenic
1083213982 11:61207165-61207187 CCACATCATAACGGGAGCACTGG + Intronic
1083216866 11:61225994-61226016 CCACATCATAACGGGAGCACTGG + Intronic
1083219748 11:61244820-61244842 CCACATCATAACGGGAGCACTGG + Intronic
1083436483 11:62646823-62646845 TCTCAGCATGACAGAAGCACTGG + Intergenic
1086629044 11:88993804-88993826 TCACTTCATCACTGCATCTCAGG - Intronic
1088402478 11:109436447-109436469 TCATATTATCACTGAGGGACTGG + Intergenic
1088981090 11:114864576-114864598 TCACAGAGTCACAGAAGCACTGG - Intergenic
1089456840 11:118630715-118630737 ACACACCAGCACTGATGCACAGG - Intronic
1089774914 11:120829305-120829327 TCACATCATCTCTGAGGAAGAGG + Intronic
1091360576 11:134975875-134975897 TCTCATCATCCCTGAAGCTGTGG + Intergenic
1202825908 11_KI270721v1_random:89174-89196 CCACCTCATCACTGCAGCAGTGG - Intergenic
1091538257 12:1434433-1434455 ACACATCTAGACTGAAGCACAGG - Intronic
1092120837 12:6042676-6042698 TCATTTCATTCCTGAAGCACTGG - Intronic
1097537554 12:60892403-60892425 TCACATCATAACTGAAAGTCAGG - Intergenic
1098156559 12:67605509-67605531 TTACACCACCACTGAAACACAGG - Intergenic
1100367798 12:93937474-93937496 TCACATGCCCACTGAGGCACAGG + Intergenic
1102215234 12:111156544-111156566 TGACAGCCTCACTGATGCACTGG + Intronic
1104169260 12:126264047-126264069 TGACATCAACACTGGGGCACCGG - Intergenic
1104678132 12:130729552-130729574 TCACATCAGCCCTGAGGCACGGG - Intergenic
1106140724 13:27008692-27008714 ACACAGCATCACTGAAACAGGGG - Intergenic
1107048106 13:36015550-36015572 TCACAGCATCATAGAAGCTCTGG - Intronic
1107820219 13:44279053-44279075 TCACATTAACACTGAAGGTCAGG - Intergenic
1108215121 13:48176409-48176431 TCAATTCATCACTGAAGGAAGGG - Intergenic
1108915873 13:55610495-55610517 TCAAATCGTCACTGAATCAAAGG + Intergenic
1110041467 13:70765444-70765466 ATCCATCAACACTGAAGCACTGG + Intergenic
1111524959 13:89456520-89456542 TCACACCAACCCTGAAGCAAGGG - Intergenic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1116611958 14:47086859-47086881 TAACATCACAACTGAAGCATAGG - Intronic
1118366699 14:65102505-65102527 CCACCTCCTCACTGCAGCACCGG + Intronic
1120446663 14:84606776-84606798 TGACATCAACAATGAAGTACAGG - Intergenic
1121487530 14:94330357-94330379 TCACATGTTCCCTGAACCACTGG + Intergenic
1122365786 14:101194195-101194217 TTCCATCTCCACTGAAGCACAGG + Intergenic
1122647544 14:103205429-103205451 TAACATCATCAAAGAAGCAGAGG - Intergenic
1124412547 15:29448272-29448294 TCCCATCATAGGTGAAGCACTGG - Intronic
1128365905 15:67002687-67002709 TCAAATCATAACTGCAGCCCTGG + Intergenic
1129972299 15:79789403-79789425 TAACATCAACAATGAAGGACTGG + Intergenic
1131291736 15:91112337-91112359 ACACATCGTGGCTGAAGCACAGG - Intronic
1131565575 15:93482445-93482467 TCACTTCATCACTGATGAAAGGG - Intergenic
1131877487 15:96825891-96825913 TATCATCATCCCTGCAGCACTGG - Intergenic
1137536903 16:49334160-49334182 TAACATCTTAACTGATGCACAGG - Intergenic
1137995678 16:53208566-53208588 TCATAGCAGCACTGCAGCACTGG - Intronic
1138525230 16:57601364-57601386 TCCCTTCATCACTAAAGCAAAGG - Intergenic
1139247649 16:65461992-65462014 ACAAATCACCACTGAAGAACTGG + Intergenic
1141372796 16:83503127-83503149 TCACATCATCAGGTAAGCAAGGG + Intronic
1142573259 17:889281-889303 TAGCTTCATCACTGAAGCACAGG - Intronic
1143664517 17:8348897-8348919 TCACATCATATCTGAAGGCCAGG + Intergenic
1147878119 17:43636102-43636124 TCACAACACCAGTGAGGCACTGG - Intergenic
1148043759 17:44729274-44729296 TCACTGCATCACTGAACTACTGG + Intronic
1149555064 17:57567729-57567751 TCAGATCATCTCTGAGGCAGTGG - Intronic
1151680768 17:75621521-75621543 TCACATCATCACTGAGGCTGAGG - Intergenic
1154494715 18:14947069-14947091 TCTCATCATCCCTGAAGCTGTGG - Intergenic
1155639119 18:27992436-27992458 TCACATCATCACTGATGTGAGGG - Intronic
1156874909 18:41998244-41998266 TCTCTTCATCACTGAAGAAAAGG + Intronic
1156966381 18:43098802-43098824 TCACAACATTACTGAAGGAATGG + Intronic
1158199541 18:54924538-54924560 TCAATTCATCACTGAAGGAGGGG + Intronic
1158817185 18:61115976-61115998 ACAAATGATCACTGAAGCTCTGG - Intergenic
1162494725 19:11017363-11017385 TCACAACCTCACTGAAGTAGGGG - Intronic
1162677996 19:12314806-12314828 TCACATCAGGAATGAAGCAGTGG - Intergenic
1165697118 19:37908932-37908954 CCACAGCATCAAAGAAGCACAGG - Intronic
929104743 2:38353761-38353783 TCACATCATCACTGAAGCACTGG + Intronic
930586239 2:53270283-53270305 TACCATCATCTCTGAAACACAGG + Intergenic
935215552 2:100972754-100972776 ATACATCATCGCTGAAGAACAGG + Intronic
936711464 2:115136331-115136353 CCACATCATCACAGAAACACTGG - Intronic
937641857 2:124221523-124221545 TCACAGCACCCCTGAAGGACAGG - Intronic
937842560 2:126538213-126538235 TCCCATCATCACTGATAGACTGG - Intergenic
939817562 2:146915246-146915268 TCATACCATCACTGACACACTGG - Intergenic
941827758 2:169918927-169918949 TCACAACTTTACAGAAGCACAGG - Intronic
943475323 2:188347058-188347080 TCACAACATCACTGATCCATAGG + Intronic
943634281 2:190288064-190288086 ACACTTGATCACTTAAGCACAGG + Intronic
945430834 2:209762769-209762791 TCAACACATCCCTGAAGCACAGG - Intergenic
946912086 2:224473881-224473903 TTACATCAACACTGAAGACCTGG + Exonic
1170440049 20:16369921-16369943 TCACATCATTACTGGATGACTGG + Intronic
1171250348 20:23641467-23641489 AAACATCATCACTGATGCCCAGG - Intergenic
1171350915 20:24502417-24502439 TCAGAGCAGCACTGATGCACAGG - Intronic
1174666365 20:52261676-52261698 TCGCATCATCATTGGAGCCCTGG - Intergenic
1177566898 21:22835444-22835466 ACACATTTTCACTGATGCACTGG - Intergenic
1184799956 22:46753103-46753125 ACCCATCCTCACTGAAGCAGAGG - Intergenic
950404795 3:12797518-12797540 TCACAGCATCACAGAACCACAGG + Intronic
951089619 3:18556985-18557007 TAATATGATCACTGAAACACTGG - Intergenic
951261195 3:20511682-20511704 TCACATCAGCTCTGCAGCAGTGG - Intergenic
952896884 3:38083443-38083465 TCACATCATCACTTAAGGCAAGG + Intronic
956161942 3:66364410-66364432 CCCCAGCATCACTGGAGCACCGG - Intronic
961934719 3:130571104-130571126 CCACATGTTCACTGAAGCCCGGG + Exonic
962348159 3:134637294-134637316 TCCCATCATCAGTGAGGCATGGG + Intronic
963270459 3:143281104-143281126 TCACTTCTACACTGAAACACAGG + Intronic
965597815 3:170425238-170425260 TCACATTCTCACAGAAGCCCCGG + Intronic
966210575 3:177449497-177449519 TGACCTCACCACAGAAGCACAGG + Intergenic
967066909 3:185926313-185926335 TCACAACAACCCTGAAGAACTGG + Intronic
967380762 3:188855023-188855045 AAACATCATCACTTAAGCATGGG + Intronic
970265434 4:14278041-14278063 TCAGCTCATCCCTGAAGCACAGG + Intergenic
976840925 4:89431581-89431603 GCACATCATCAAGGAGGCACAGG + Intergenic
978086999 4:104666965-104666987 TGAGATCATCACTGCATCACAGG - Intergenic
982213318 4:153058650-153058672 TCACATAATCATTAAAGCAGAGG - Intergenic
986581144 5:9267008-9267030 TCACGTCTTCACTGAATCTCAGG - Intronic
988504658 5:31811378-31811400 TTACACCATCACTGCAGCCCTGG - Intronic
989689835 5:44128274-44128296 CCACATCATCAGTGATGCTCAGG - Intergenic
991988389 5:72313173-72313195 TCACATCATCAGTAAAGAAAAGG + Intronic
992145850 5:73846764-73846786 TCCCATCATCTCTTAAGCAAAGG + Intronic
993300901 5:86208822-86208844 TCAGAACATCACTTGAGCACAGG + Intergenic
995616438 5:113969507-113969529 TCATATCCTCACTGAAGGAAAGG - Intergenic
998801732 5:145875762-145875784 ACACACCATCAATGAATCACAGG + Intergenic
999956267 5:156705855-156705877 TCACATCACTACTAAAGGACTGG - Intronic
1000029875 5:157392721-157392743 TGACATGATCACTGATGCAGGGG + Intronic
1000363404 5:160468667-160468689 CCACATCTTTACTAAAGCACTGG - Intergenic
1002819329 6:710324-710346 TTGCTTCATCACTGTAGCACTGG - Intergenic
1003501310 6:6705255-6705277 TGACAACAACACTGAACCACTGG - Intergenic
1010557862 6:77307043-77307065 TCAAATCATCATTGAAATACAGG + Intergenic
1014754395 6:125287657-125287679 GCACATGATCGCTGAAGCACAGG + Intronic
1016293450 6:142549090-142549112 TCACATCATCAAAAAGGCACAGG + Intergenic
1016493470 6:144633087-144633109 GCACATAAGCAATGAAGCACTGG - Intronic
1017046862 6:150355209-150355231 GCACATCATCACAGAGGCAGGGG - Intergenic
1017158595 6:151344307-151344329 TGGCATCACCACTGAAGCAAAGG + Intronic
1017951818 6:159141591-159141613 TCACTGAATCACTGAATCACAGG - Intergenic
1018287437 6:162255932-162255954 TCACAACCCCACTGATGCACTGG + Intronic
1018441022 6:163813540-163813562 TAACATCCTTACTGAAGCATGGG + Intergenic
1019835507 7:3379040-3379062 TCCCATTATCAGTGCAGCACAGG - Intronic
1021876270 7:25052487-25052509 TATCATCATCACTAAAGCAAAGG - Intergenic
1023418774 7:39956630-39956652 TCACATCATCACTGCACTCCAGG - Intronic
1024690054 7:51790476-51790498 CTATATCATCACTGAACCACTGG - Intergenic
1026627768 7:72011454-72011476 GGACACCATCCCTGAAGCACAGG + Intronic
1028367078 7:90045918-90045940 TCACTTAATCACTGAAGGAATGG - Intergenic
1029971231 7:104791488-104791510 TCACATGATCACTGTAGTTCAGG + Intronic
1030908509 7:115216270-115216292 TCAAAACATTACTGAAGCACTGG - Intergenic
1032226762 7:130038283-130038305 TCACAGCAGCACTGAAGTAAGGG - Intronic
1033143523 7:138850006-138850028 GCAAATGTTCACTGAAGCACTGG - Intronic
1033621649 7:143067183-143067205 TCACAGCATCATTGTGGCACGGG - Intergenic
1035081111 7:156216756-156216778 TCAGACCATCACTGACTCACTGG - Intergenic
1035544692 8:470729-470751 TTCCATTATCCCTGAAGCACAGG + Intronic
1037636260 8:20703389-20703411 TCACATAGTCACTGCAGCAGTGG - Intergenic
1040380273 8:46865344-46865366 GCACATGCTCACTGAAGCCCAGG + Intergenic
1048478429 8:134764873-134764895 GCACCTCATCAGGGAAGCACGGG + Intergenic
1048809351 8:138271089-138271111 TCACATCATCCAAGAAGCCCTGG - Intronic
1050144005 9:2546252-2546274 ACACATGTTCACTGAAGCAAAGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057496050 9:95562369-95562391 TCACCTCATCACTCTAGGACTGG + Intergenic
1059988877 9:119845867-119845889 TCTCATCATCAGTGAAGCTGGGG - Intergenic
1062117484 9:134817229-134817251 CCACATCATCACCTAATCACAGG + Intronic
1186224366 X:7381880-7381902 TCACATCACCACTGAAATAGTGG + Intergenic
1186606502 X:11098306-11098328 TCACTTCACCAATGAAGCAGTGG + Intergenic
1187541434 X:20199816-20199838 TAACTTCATCACTGTAACACAGG + Intronic
1188682469 X:33027761-33027783 TCACTTCATCAAGGAAGCTCTGG - Intronic
1189566912 X:42251410-42251432 TCACATATTCCCTGAAGAACAGG - Intergenic
1194549274 X:95275211-95275233 TCACATCACCTCTGCAGCAAGGG + Intergenic
1198240049 X:134776283-134776305 TCACATTAACACTGAAGCACGGG + Intronic
1199306424 X:146272104-146272126 ACACATCTTCACTGAAGCAGGGG + Intergenic
1201291425 Y:12423921-12423943 TCACATCCTTGCTGAAGCACAGG - Intergenic