ID: 929106925

View in Genome Browser
Species Human (GRCh38)
Location 2:38374758-38374780
Sequence CTTTTTCCACAGTTGGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929106925_929106928 -6 Left 929106925 2:38374758-38374780 CCTAATACCAACTGTGGAAAAAG 0: 1
1: 0
2: 1
3: 22
4: 273
Right 929106928 2:38374775-38374797 AAAAAGCCTAATTTTGGAAAAGG 0: 1
1: 1
2: 6
3: 58
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929106925 Original CRISPR CTTTTTCCACAGTTGGTATT AGG (reversed) Intronic
901092530 1:6651592-6651614 CTTTTCAAACAGTTGGAATTTGG - Exonic
902356822 1:15908765-15908787 CATTTTACACACTTGATATTGGG + Intronic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
904956764 1:34291086-34291108 GTTTTTCCACAAGTGGGATTGGG + Intergenic
905556429 1:38888873-38888895 ACTTTACCACAGTTGGTAGTTGG - Intronic
906846896 1:49202533-49202555 CTTCTTCAACAATTGGTATTGGG + Intronic
910824965 1:91397073-91397095 GTTTTTCCACAGATGGTTTCGGG - Intronic
911374676 1:97037438-97037460 CTTTTTCAAAAGATGGTTTTGGG - Intergenic
916292193 1:163179013-163179035 TTTTTGCCACAGTTGGGAGTTGG - Intronic
916929800 1:169564710-169564732 GATTTTCCACAGTTGGGATGGGG - Intronic
917337250 1:173938142-173938164 CTTTTCCCAGAGCTGTTATTTGG - Exonic
918399974 1:184153523-184153545 ATTTTTGCCCAGTGGGTATTTGG + Intergenic
918472673 1:184890254-184890276 CTTTTTCCCCATTTGATTTTTGG + Intronic
918785868 1:188762103-188762125 TTTTTTCCATAATTGGTATGTGG + Intergenic
920231483 1:204473394-204473416 TTTTATCCACAGTGGGTATGAGG + Intronic
920714328 1:208325472-208325494 CTTTTCCCTCTGTTGGGATTAGG + Intergenic
920732523 1:208501122-208501144 TTTTTTCCACACCTGGTTTTTGG - Intergenic
920776111 1:208938779-208938801 CCTTTTCCAGAGTTGGCATGGGG - Intergenic
922226153 1:223647560-223647582 CTTTTTCCAAAGAGGGTTTTAGG - Intronic
922671415 1:227510934-227510956 CTTTTCCTACAGTTGGAATGAGG - Intergenic
924326583 1:242900900-242900922 CTTTTCACACAGTTGTTCTTTGG - Intergenic
1063086918 10:2828229-2828251 CTTATTCTACAGCTGTTATTTGG + Intergenic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1064811777 10:19208095-19208117 TTTTTACCACAGTTGGTTGTGGG + Intronic
1065010610 10:21417374-21417396 CTTTTTGCCCAGTTGGGATTAGG - Intergenic
1065457567 10:25923044-25923066 CTTTTGCCATTGTTGGTACTAGG - Intergenic
1066161561 10:32737331-32737353 CTTTATCTACTTTTGGTATTAGG + Intronic
1067403703 10:46001058-46001080 TTTTTTCCACATTAGGAATTTGG + Intronic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1069156356 10:65035301-65035323 CTTCTTCTACAGTTGGTACTAGG - Intergenic
1069605258 10:69735062-69735084 GTGGTTCCACAGTTGGTTTTAGG + Intergenic
1071314516 10:84381276-84381298 CTTCATCCGAAGTTGGTATTAGG + Intronic
1072164664 10:92801687-92801709 CTTTTTCCCCATTGGGTATCTGG + Intergenic
1073035257 10:100560354-100560376 CTTCTTACACAGTTGCTATAGGG - Intergenic
1074163189 10:110851224-110851246 CCTTTTCCAAAGCTGGCATTAGG - Intergenic
1079642260 11:22820697-22820719 TTTGTTCCACTGCTGGTATTTGG - Exonic
1079955344 11:26855810-26855832 TTTTTTCCTCAGTAGGAATTGGG - Intergenic
1081078107 11:38701274-38701296 CATTTTCCAAAGTTAATATTTGG - Intergenic
1081196789 11:40171032-40171054 CCTTTTCCAAAATTGGTTTTAGG - Intronic
1085620821 11:78036930-78036952 CATTTTACACAGTTTGTCTTAGG + Intronic
1086074058 11:82831281-82831303 TTTATTCCACAGTTGCTTTTTGG - Intronic
1087082192 11:94182028-94182050 CTATTTACATAGTTGGAATTGGG - Intergenic
1087446566 11:98262262-98262284 CTTTTTATACAATTGGTAATAGG + Intergenic
1088903476 11:114136323-114136345 CTGTTTCCACAGTTGCTTTTGGG - Intronic
1089772215 11:120811508-120811530 CTATTTCCTCAGTTTGTTTTGGG + Intronic
1089938770 11:122393969-122393991 TTTGTTCCACAGTTGGAAATAGG + Intergenic
1092546668 12:9458019-9458041 CTTTTTCCAAAGAGGGTCTTGGG + Intergenic
1092915136 12:13182668-13182690 CTTTTTACAGGGTTGTTATTAGG + Intergenic
1093834510 12:23810781-23810803 CTTTATCCACTGTTGGGCTTGGG - Intronic
1094506269 12:31064053-31064075 CTTTTTCCAAAGAGGGTCTTGGG - Intergenic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1097583874 12:61492018-61492040 CTTTTTCCACTGTTAGTAAAAGG + Intergenic
1097824636 12:64162431-64162453 ATTTTTCCACAGATGATAGTGGG - Intergenic
1098005394 12:65991915-65991937 CTTCTTAAACATTTGGTATTTGG + Intergenic
1099466828 12:82999251-82999273 AATGTTCCTCAGTTGGTATTTGG + Intronic
1100459124 12:94781031-94781053 CTTCTTCCTCAGTTGGTGTTTGG - Intergenic
1101785721 12:107881647-107881669 CTTTTTCCTCTTTTGGTAGTGGG - Intergenic
1104257024 12:127147750-127147772 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
1104306041 12:127611665-127611687 CATTTTCTCCTGTTGGTATTGGG - Intergenic
1105405784 13:20131503-20131525 CTATTTCCTTATTTGGTATTTGG + Intergenic
1106459125 13:29953234-29953256 CTTCTTCCACAGTTTGTGCTTGG + Intergenic
1107087123 13:36437426-36437448 CTTTGTCTACATTTGATATTTGG - Intronic
1108256998 13:48620502-48620524 CTTTTTCCATTGTTGGAACTTGG - Intergenic
1111963633 13:94838264-94838286 CTTTTTCAACAAATGGTACTGGG + Intergenic
1112846065 13:103645629-103645651 CTTTGAAAACAGTTGGTATTAGG + Intergenic
1113881885 13:113631608-113631630 CTTTTTCGACTGTAGGTAATTGG + Exonic
1114267854 14:21083141-21083163 CTATTTCCACAGCTGGTAAATGG + Intronic
1115622584 14:35154641-35154663 AGTTTCCCACAGATGGTATTTGG - Intronic
1117656462 14:57961228-57961250 ATTTTTCAAGAGATGGTATTTGG - Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1119454434 14:74742514-74742536 GTTTTTCCACAGATGGCAGTGGG + Intergenic
1120048040 14:79830664-79830686 CGTTTTCCTCAGTTGCAATTTGG - Intronic
1120381118 14:83780999-83781021 CTTTTTCCACTGTTGTCTTTAGG + Intergenic
1121057443 14:90870415-90870437 TTTTGTCCACAGTGGTTATTGGG - Exonic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1123681452 15:22767044-22767066 CTTTTCCCACATTTGGTGATTGG + Intergenic
1124333664 15:28841502-28841524 CTTTTCCCACATTTGGTGATCGG + Intergenic
1124532436 15:30519340-30519362 CTTTTCCCACATTTGGTGATCGG - Intergenic
1124766217 15:32488305-32488327 CTTTTCCCACATTTGGTGATCGG + Intergenic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1127897522 15:63315515-63315537 CTTTTTCCAAAGAGGGTTTTAGG + Intergenic
1128436955 15:67662277-67662299 CTTATTTCACAGTTGCTCTTAGG + Intronic
1130286413 15:82558826-82558848 CGTTTTCCACACTTGGCCTTGGG + Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1134876559 16:17705024-17705046 CCTTTTCCAGAGTTGGGAATTGG - Intergenic
1137689807 16:50415436-50415458 CGTTTTCAACAGATGGTACTGGG - Intergenic
1142106706 16:88308067-88308089 TTTTTGCAACAGATGGTATTGGG - Intergenic
1143578448 17:7809178-7809200 TGTTTTCCAAAGTTGGTTTTAGG - Intronic
1145781103 17:27563955-27563977 TTATTTGTACAGTTGGTATTCGG + Intronic
1146261668 17:31426018-31426040 CTTTTGCCACAGATGGTCCTCGG - Intronic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1149073752 17:52574564-52574586 CATTTTCTCCTGTTGGTATTGGG - Intergenic
1149213315 17:54328000-54328022 CGTTTTCTCCTGTTGGTATTGGG + Intergenic
1149751404 17:59149011-59149033 CCTTATCAACACTTGGTATTAGG - Intronic
1151309164 17:73282924-73282946 CTTTTTATACAGTTGTGATTAGG - Intergenic
1151615338 17:75206481-75206503 CTTTTTCCAAAGATGGTTTTGGG + Intronic
1153054379 18:931534-931556 GTTTTTCCACAATAGGTATATGG - Intergenic
1154232186 18:12566862-12566884 CTTTTTCTGCTTTTGGTATTAGG - Intronic
1154482661 18:14850279-14850301 CTTTTTCCTAAGTTGCTCTTCGG - Exonic
1155137765 18:23013362-23013384 CTTTTTGCAGAGTCGGTTTTTGG + Intronic
1155476258 18:26238213-26238235 CATTTTCTCCTGTTGGTATTGGG + Intronic
1156530191 18:37807647-37807669 ATTTTTCCACAAGTGGAATTGGG + Intergenic
1156681294 18:39592014-39592036 CTTTTTCCACATTTAGCATTGGG + Intergenic
1156884440 18:42118037-42118059 CTTTTTACTGAGATGGTATTAGG - Intergenic
1159894902 18:73987333-73987355 CTTTTTGCAAAGGTGGTTTTGGG - Intergenic
1159955643 18:74516647-74516669 CTTGGTCCAAAGTTGGTGTTTGG - Intronic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1160442560 18:78903492-78903514 CTTCATCCCCAGTTGTTATTTGG - Intergenic
1162264137 19:9556698-9556720 CTTTTTCCTAAATTTGTATTTGG + Intergenic
1164699126 19:30269920-30269942 ATTTTTCCACAGTCGTTACTGGG + Intronic
1164803297 19:31095947-31095969 CTTTGTCCTCAGATGCTATTGGG - Intergenic
1168373392 19:55855328-55855350 CTCTTTTCACAGTTGGTTTGAGG + Intronic
925419138 2:3697266-3697288 CTTTTTCACCTGTTGGTTTTCGG + Intronic
926919271 2:17924821-17924843 CTTTTTCTAGTTTTGGTATTAGG + Intronic
927288470 2:21380850-21380872 CTTTTTCAACAACTGGTGTTGGG + Intergenic
928252343 2:29692434-29692456 ATTTTTCCACGGATGGTTTTGGG + Intronic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
929160481 2:38827218-38827240 ATTTTTCCCAAGTTGGTATGAGG - Intronic
929294223 2:40228511-40228533 CTTTTTCCACTGTGGGATTTTGG - Intronic
931348026 2:61464460-61464482 CTTTTTCACCAAATGGTATTGGG + Intronic
933231408 2:79811673-79811695 CTTTTTTCAAAATTGGTTTTGGG + Intronic
933361017 2:81284321-81284343 ATTTAACCACAATTGGTATTAGG - Intergenic
935712999 2:105915930-105915952 CTTTTTCCAAAGATGATTTTGGG + Intergenic
936122487 2:109758885-109758907 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
936222206 2:110612587-110612609 CTTTTTCCAAAGAGGGTTTTGGG - Intergenic
936517311 2:113190246-113190268 CTTTTTCAACAAATGGTGTTGGG - Intronic
936890844 2:117367708-117367730 TTTTTGCCACATTTGCTATTGGG - Intergenic
937806877 2:126155947-126155969 CTTTTTCCAGTTTTGGTACTCGG + Intergenic
939364939 2:141219248-141219270 CATTTTCCACTGCTGGTGTTGGG + Intronic
939546095 2:143555211-143555233 CATTTTACACACTTTGTATTAGG - Intronic
939848495 2:147276580-147276602 TTTTTTCCACAGAAGGTAGTTGG + Intergenic
940439128 2:153693588-153693610 CTTTTTCCAAAGAAGGTTTTGGG + Intergenic
941133679 2:161686124-161686146 CTTTTTCCAAATTTGTCATTTGG - Intronic
941343454 2:164337209-164337231 CTTGTTACAGAGTTGGTAATTGG - Intergenic
942380220 2:175383083-175383105 TTTTTTCCAAAGTTGTTATTTGG - Intergenic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944533803 2:200690047-200690069 CTTTGTCCCCAGTTGGTTGTTGG - Intergenic
944552010 2:200852628-200852650 ATCTTTCCACAGTTGTTTTTTGG - Intergenic
945296447 2:208175868-208175890 CTTTTGCCACATTTTGAATTAGG - Intronic
947558024 2:231115367-231115389 CTGTTTCCAGAGTTGGTATGTGG + Intronic
1170416896 20:16153301-16153323 GTTTTTCTGCTGTTGGTATTGGG - Intergenic
1171071332 20:22071110-22071132 CTTTTTCCACACTTGAATTTTGG - Intergenic
1172711165 20:36924750-36924772 CTGTTTCCACACTTGTTACTTGG - Intronic
1174550149 20:51356296-51356318 CTTACTCCACAGCTGGTGTTGGG + Intergenic
1175317900 20:58064549-58064571 CTTGTTCCACAGTTGGGGATCGG + Intergenic
1176243463 20:64085595-64085617 CTTATTCCACAGTTTAAATTAGG + Intronic
1176915870 21:14624680-14624702 CTTTTACCTCTGTTAGTATTTGG - Intronic
1176955053 21:15092810-15092832 CTTTTTACATAGTTGGAAGTGGG - Intergenic
1177134924 21:17298271-17298293 CATTTTCTCCTGTTGGTATTGGG - Intergenic
1177369990 21:20189919-20189941 CTTTTTCCAAACTTGTCATTTGG + Intergenic
1177888943 21:26781598-26781620 CTGTGTCCAGAGTTTGTATTAGG + Intergenic
1178721651 21:35016059-35016081 CGTTTTCCAAAGCTGTTATTAGG - Intronic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
949534680 3:4986777-4986799 CTTTGTCCGCAGTGGGCATTAGG - Intergenic
950461952 3:13128958-13128980 CTTTGTCCAATTTTGGTATTCGG + Intergenic
950513003 3:13444424-13444446 CTTTGTCAACATTTGGTATCAGG - Intergenic
951631299 3:24724120-24724142 TTTTTTTCACTGTTGGTCTTTGG - Intergenic
951811298 3:26703070-26703092 ATTTTTCCACTGCTGGTCTTTGG - Intronic
951830658 3:26922925-26922947 CTTTTTCTACACTTGGTTTGAGG + Intergenic
952375596 3:32764670-32764692 CTTTTTCCCCAGCTGGTAAGCGG + Exonic
952609671 3:35193072-35193094 CTTTTTACACAGTAGGTATGGGG - Intergenic
954246356 3:49334965-49334987 CTTTTCCCACAGTTCCCATTGGG + Intronic
954502539 3:51032198-51032220 ATTTTTCCACAGTTTATTTTGGG + Intronic
955773777 3:62412586-62412608 CATTTTACAGAGTTGGAATTTGG - Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957732841 3:84163521-84163543 GTTTTTCAACAAATGGTATTGGG - Intergenic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
958087922 3:88836444-88836466 CGTTTTCAACAGATGGTGTTGGG - Intergenic
958858868 3:99420737-99420759 CTTTTTTCCCAGTTGGGATAAGG + Intergenic
959243863 3:103837388-103837410 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961342083 3:126232483-126232505 CTTTGTCTGCATTTGGTATTAGG + Intergenic
962083127 3:132161621-132161643 CATTTTCCCCATATGGTATTGGG - Intronic
963206835 3:142644868-142644890 CAATTTCCAGAGTTGGTAGTGGG + Intronic
963423747 3:145096334-145096356 CTTTTTGCACATTAGGTATTTGG + Intergenic
965949752 3:174293998-174294020 CTTTTTCCAAACTTTCTATTTGG - Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
967265897 3:187691897-187691919 GTTTTTCCAAGGTTGGTAATGGG + Intergenic
968861604 4:3175967-3175989 GATTTTCCACAGTGGGTATTGGG + Intronic
971298049 4:25417539-25417561 GTTTTACTACAGGTGGTATTAGG - Intronic
971338738 4:25748367-25748389 TCTTTTCAACAGCTGGTATTGGG - Exonic
971935284 4:33139591-33139613 CTTTCTCCTTAGTTTGTATTGGG + Intergenic
972133453 4:35863710-35863732 CATTTTCTCCTGTTGGTATTGGG + Intergenic
972448621 4:39172832-39172854 TTTTTTCAACAATTGGTGTTGGG - Intergenic
973088092 4:46094302-46094324 TTCTTTCCAGATTTGGTATTTGG - Intronic
973150158 4:46877705-46877727 ATTTTTTGACATTTGGTATTTGG - Intronic
975143917 4:70946758-70946780 CTTTTTCCAAAGAGGGTTTTGGG + Intronic
975359979 4:73457879-73457901 CGTTTTCCTCACTTGGTGTTCGG + Intergenic
977668576 4:99669722-99669744 AATTTTACACAGTTGCTATTAGG + Intergenic
978780249 4:112544899-112544921 TCTTTTCCACACATGGTATTGGG + Intronic
980751935 4:137101870-137101892 CTTTGTCCATCTTTGGTATTAGG - Intergenic
981091646 4:140738505-140738527 CTTTTTCCAAAGATGGTTTTGGG - Intronic
983631406 4:169853187-169853209 CTTTTTCCAAAGGGGGTTTTTGG - Intergenic
986203051 5:5597225-5597247 CTTTTTCCTCATTTTGTAATGGG + Intergenic
986392442 5:7299043-7299065 CTTTTCCCACATTTGGTGATCGG + Intergenic
987695526 5:21324825-21324847 CTTTTTTCACAGTTCATTTTTGG - Intergenic
988328440 5:29801867-29801889 CTTTATCCAGTTTTGGTATTAGG - Intergenic
988561224 5:32283312-32283334 CTTTTTCCAAAGTGGGTACAGGG + Intronic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
990172511 5:53069301-53069323 TTTTTTCATGAGTTGGTATTAGG + Intronic
991458037 5:66825590-66825612 TGTTTTTCTCAGTTGGTATTTGG + Intronic
991744879 5:69727274-69727296 CTTTTTTCACAGTTCATTTTTGG + Intergenic
991752826 5:69827952-69827974 CTTTTTTCACAGTTCATTTTTGG - Intergenic
991796449 5:70307002-70307024 CTTTTTTCACAGTTCATTTTTGG + Intergenic
991802444 5:70384686-70384708 CTTTTTTCACAGTTCATTTTTGG - Intergenic
991824259 5:70602588-70602610 CTTTTTTCACAGTTCATTTTTGG + Intergenic
991832145 5:70703080-70703102 CTTTTTTCACAGTTCATTTTTGG - Intergenic
991888827 5:71306558-71306580 CTTTTTTCACAGTTCATTTTTGG + Intergenic
992587340 5:78253562-78253584 CTTTTTCCAGAATTGGTGCTTGG - Intronic
993177496 5:84506653-84506675 CTTTTTCCACATTTAGTTCTTGG - Intergenic
995137604 5:108696731-108696753 CTTCTGCCTCAGTTGGGATTCGG - Intergenic
995659303 5:114463143-114463165 CCTTTTCCACAGTATGTGTTAGG - Exonic
998564940 5:143208561-143208583 CTTTTTCCACAGTAGGGTTCAGG - Intronic
998880761 5:146642399-146642421 CTTTTTCTAAACTTGGGATTAGG - Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
1000606294 5:163331119-163331141 ATTTTTGCACAGGTGGTGTTAGG + Intergenic
1002142259 5:177149596-177149618 GTTTTTCCACAGGTGGGAGTGGG + Intronic
1004078152 6:12364185-12364207 CTTTTTCCTCAGATGCCATTAGG - Intergenic
1004565791 6:16796214-16796236 CTTTTTCCACAATTAGTGCTAGG + Intergenic
1005555258 6:26973277-26973299 CTTTTTTCACAGTTCATTTTTGG + Intergenic
1008165950 6:48138582-48138604 CTGTTTTAACGGTTGGTATTTGG + Intergenic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008879339 6:56364830-56364852 CTTTTACCACAGCTATTATTGGG + Intronic
1009743780 6:67785106-67785128 CTTATACCACATTTGATATTTGG - Intergenic
1011536864 6:88384949-88384971 ATTTTTGCACAGGTGGTATGTGG - Intergenic
1012367857 6:98464185-98464207 CCTTTTCCCCAGTTTGAATTTGG - Intergenic
1012872337 6:104687021-104687043 CTTTTTCCCCAGTTGAAGTTTGG - Intergenic
1013998618 6:116339369-116339391 TTTTTTTCACAATTGGAATTTGG + Intronic
1014344243 6:120247610-120247632 CTTTTGCCAAAGTTGGCCTTTGG + Intergenic
1014712165 6:124819711-124819733 CTGTTTCAACAGTAGGTAATAGG - Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1016550916 6:145279033-145279055 CTCTTTCCACAATTGGAAATTGG + Intergenic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017556033 6:155569771-155569793 CCTTTTCTAGAGTTGGTATTAGG + Intergenic
1017957066 6:159187480-159187502 TGTTTTCCACAGTTGGCATTGGG - Intronic
1018130418 6:160725746-160725768 CATTTTCCACACTTGGTTTTTGG - Intronic
1019887258 7:3916083-3916105 CTTTTTCCAAAGAGGGTTTTTGG + Intronic
1021373292 7:19877223-19877245 ATTTTTCCATAGGTGGTATTTGG + Intergenic
1022168961 7:27804343-27804365 CTTTTTCCACATTTGTCCTTTGG + Intronic
1022272132 7:28818796-28818818 ATTTTTCCACATTTGATATACGG + Intronic
1023187534 7:37547814-37547836 CTTTTTCCAAAGGTGGTTTTGGG + Intergenic
1023235097 7:38077432-38077454 CTTTTTCTGATGTTGGTATTAGG - Intergenic
1024505979 7:50161859-50161881 TTTTTTCAATAGATGGTATTGGG + Intergenic
1024682084 7:51701844-51701866 CTTTGTCTAGTGTTGGTATTAGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025745745 7:64241314-64241336 CTGTCTCCACAATTGGGATTGGG - Intronic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1025932764 7:66009879-66009901 CTCACTCCACAGTTGGTTTTTGG - Intergenic
1028977728 7:96932692-96932714 GATTTTTCACAGTTGGAATTTGG + Intergenic
1033814176 7:145052214-145052236 GTTATTCCACCTTTGGTATTTGG + Intergenic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1035433949 7:158843841-158843863 CTTTTTCCAAAGAGGGTTTTGGG + Intergenic
1038736617 8:30175350-30175372 CTTTTCCCTCATATGGTATTTGG - Intronic
1039814697 8:41082796-41082818 CCTTTTCCTCACTTGGAATTTGG - Intergenic
1039944579 8:42118433-42118455 CTCTTTCCACACTTGGTGGTCGG - Intergenic
1040377793 8:46843160-46843182 GCTTTTCCACATTTGGAATTGGG + Intergenic
1040748383 8:50674151-50674173 CTCTTTCCAGTTTTGGTATTAGG + Intronic
1040797021 8:51298165-51298187 CATTTTCTCCTGTTGGTATTGGG + Intergenic
1041492086 8:58444237-58444259 TTTTTTCCAGAGTTGTTGTTAGG + Intronic
1041818378 8:62000577-62000599 CTTTTTCAACAAATGGTACTAGG - Intergenic
1043152872 8:76740479-76740501 TTTTTTCCCCAGTAGGTTTTGGG - Intronic
1044250365 8:89998914-89998936 CTTTTTCCAAAGGGGGTTTTGGG - Intronic
1045838242 8:106548887-106548909 CTTTTTCTGCAGCTGGTTTTAGG - Intronic
1046069445 8:109232780-109232802 CATTTTACAGAGTCGGTATTGGG + Intergenic
1046476373 8:114749930-114749952 CTTTTTCCAAAGATGGTTTTGGG - Intergenic
1047538594 8:125742625-125742647 CTTTTCCCACAGTGGGTGTGAGG + Intergenic
1050303901 9:4286859-4286881 CTTTTGCTACAGTGGGTCTTGGG + Intronic
1050982647 9:12039506-12039528 CTTTTCCCAGTTTTGGTATTAGG - Intergenic
1051032035 9:12692863-12692885 CATTTTTCACTGTTGGTATATGG + Intronic
1051807635 9:21013260-21013282 CTTTTTCAACAAATGGTGTTGGG - Intronic
1052030923 9:23627895-23627917 TTTTTTCCCCAATTGGTAATTGG - Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1054804157 9:69381886-69381908 CTCTTTCCCCAGTTGTTCTTCGG + Intronic
1054921110 9:70543030-70543052 CTTTTTCCAAAGCTGATCTTTGG - Intronic
1055666562 9:78558664-78558686 CTGTTTCCTCAGTGAGTATTGGG + Intergenic
1056421231 9:86428524-86428546 CTTTTTCCACTGATTGTCTTGGG + Intergenic
1056963408 9:91146376-91146398 CATTTTCCACAGTGTGGATTGGG - Intergenic
1058181416 9:101804857-101804879 CTTTATCCAGAGGTGGTATCTGG + Intergenic
1059981555 9:119777947-119777969 CTTTTTCTAAAGCTGGAATTAGG - Intergenic
1060517771 9:124276459-124276481 CTTTTTCCACTCTTGCTCTTAGG - Intronic
1185824710 X:3239078-3239100 CTTTTTTCACAGCTGCTTTTTGG + Intergenic
1187251665 X:17604432-17604454 CTGTTACCACATTTGGGATTGGG + Intronic
1190861471 X:54348813-54348835 TTATTTCCTCAGTTGGTAGTAGG - Intronic
1193779148 X:85682225-85682247 CTTTTGGCACAGTTTATATTAGG + Intergenic
1197958760 X:131980923-131980945 CTTTTTTTACATTTGTTATTGGG - Intergenic
1198241427 X:134791045-134791067 CTTTCTCCCCAGTTAGTTTTTGG - Intronic
1198354182 X:135834371-135834393 CTTTTTCCTAAGTTGGTGATAGG - Intronic
1198925363 X:141785841-141785863 CTTTGTCCAGTTTTGGTATTAGG + Intergenic
1199076441 X:143531348-143531370 TTTATTCCAAAGATGGTATTTGG + Intergenic
1199642706 X:149879848-149879870 ATTTTTACACAGTTGATTTTGGG - Intergenic
1199695315 X:150339747-150339769 CTTTTTCAGCAGTGGGGATTTGG - Intergenic
1200776043 Y:7171194-7171216 CATTTTCTCCTGTTGGTATTGGG - Intergenic
1201224011 Y:11799468-11799490 CTTTTCACACAGTTGTTCTTTGG - Intergenic
1201913682 Y:19159046-19159068 CTTTATCTACATTTGGTACTTGG - Intergenic