ID: 929110106

View in Genome Browser
Species Human (GRCh38)
Location 2:38399112-38399134
Sequence ACACTAACCCGATTTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929110106_929110108 22 Left 929110106 2:38399112-38399134 CCATAAGGAAATCGGGTTAGTGT No data
Right 929110108 2:38399157-38399179 CCGAAACATTTCTTTAAGCATGG No data
929110106_929110109 25 Left 929110106 2:38399112-38399134 CCATAAGGAAATCGGGTTAGTGT No data
Right 929110109 2:38399160-38399182 AAACATTTCTTTAAGCATGGAGG No data
929110106_929110110 26 Left 929110106 2:38399112-38399134 CCATAAGGAAATCGGGTTAGTGT No data
Right 929110110 2:38399161-38399183 AACATTTCTTTAAGCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929110106 Original CRISPR ACACTAACCCGATTTCCTTA TGG (reversed) Intergenic