ID: 929115365

View in Genome Browser
Species Human (GRCh38)
Location 2:38439420-38439442
Sequence GAGTGTTGTGGGCAAGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929115365_929115371 4 Left 929115365 2:38439420-38439442 CCATGACCTTGCCCACAACACTC No data
Right 929115371 2:38439447-38439469 TGGCACTTTCAGCTGCTTCATGG No data
929115365_929115372 5 Left 929115365 2:38439420-38439442 CCATGACCTTGCCCACAACACTC No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929115365 Original CRISPR GAGTGTTGTGGGCAAGGTCA TGG (reversed) Intergenic
No off target data available for this crispr