ID: 929115366

View in Genome Browser
Species Human (GRCh38)
Location 2:38439426-38439448
Sequence CAGTTGGAGTGTTGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929115366_929115372 -1 Left 929115366 2:38439426-38439448 CCTTGCCCACAACACTCCAACTG No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115366_929115371 -2 Left 929115366 2:38439426-38439448 CCTTGCCCACAACACTCCAACTG No data
Right 929115371 2:38439447-38439469 TGGCACTTTCAGCTGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929115366 Original CRISPR CAGTTGGAGTGTTGTGGGCA AGG (reversed) Intergenic