ID: 929115368 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:38439431-38439453 |
| Sequence | AGTGCCAGTTGGAGTGTTGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929115368_929115371 | -7 | Left | 929115368 | 2:38439431-38439453 | CCCACAACACTCCAACTGGCACT | No data | ||
| Right | 929115371 | 2:38439447-38439469 | TGGCACTTTCAGCTGCTTCATGG | No data | ||||
| 929115368_929115373 | 27 | Left | 929115368 | 2:38439431-38439453 | CCCACAACACTCCAACTGGCACT | No data | ||
| Right | 929115373 | 2:38439481-38439503 | CAACACTGCATGTAAAATACTGG | No data | ||||
| 929115368_929115372 | -6 | Left | 929115368 | 2:38439431-38439453 | CCCACAACACTCCAACTGGCACT | No data | ||
| Right | 929115372 | 2:38439448-38439470 | GGCACTTTCAGCTGCTTCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929115368 | Original CRISPR | AGTGCCAGTTGGAGTGTTGT GGG (reversed) | Intergenic | ||