ID: 929115368

View in Genome Browser
Species Human (GRCh38)
Location 2:38439431-38439453
Sequence AGTGCCAGTTGGAGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929115368_929115372 -6 Left 929115368 2:38439431-38439453 CCCACAACACTCCAACTGGCACT No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115368_929115371 -7 Left 929115368 2:38439431-38439453 CCCACAACACTCCAACTGGCACT No data
Right 929115371 2:38439447-38439469 TGGCACTTTCAGCTGCTTCATGG No data
929115368_929115373 27 Left 929115368 2:38439431-38439453 CCCACAACACTCCAACTGGCACT No data
Right 929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929115368 Original CRISPR AGTGCCAGTTGGAGTGTTGT GGG (reversed) Intergenic
No off target data available for this crispr