ID: 929115369

View in Genome Browser
Species Human (GRCh38)
Location 2:38439432-38439454
Sequence AAGTGCCAGTTGGAGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929115369_929115372 -7 Left 929115369 2:38439432-38439454 CCACAACACTCCAACTGGCACTT No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115369_929115373 26 Left 929115369 2:38439432-38439454 CCACAACACTCCAACTGGCACTT No data
Right 929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG No data
929115369_929115371 -8 Left 929115369 2:38439432-38439454 CCACAACACTCCAACTGGCACTT No data
Right 929115371 2:38439447-38439469 TGGCACTTTCAGCTGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929115369 Original CRISPR AAGTGCCAGTTGGAGTGTTG TGG (reversed) Intergenic
No off target data available for this crispr