ID: 929115372

View in Genome Browser
Species Human (GRCh38)
Location 2:38439448-38439470
Sequence GGCACTTTCAGCTGCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929115368_929115372 -6 Left 929115368 2:38439431-38439453 CCCACAACACTCCAACTGGCACT No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115365_929115372 5 Left 929115365 2:38439420-38439442 CCATGACCTTGCCCACAACACTC No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115366_929115372 -1 Left 929115366 2:38439426-38439448 CCTTGCCCACAACACTCCAACTG No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115364_929115372 6 Left 929115364 2:38439419-38439441 CCCATGACCTTGCCCACAACACT No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data
929115369_929115372 -7 Left 929115369 2:38439432-38439454 CCACAACACTCCAACTGGCACTT No data
Right 929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929115372 Original CRISPR GGCACTTTCAGCTGCTTCAT GGG Intergenic