ID: 929115373 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:38439481-38439503 |
Sequence | CAACACTGCATGTAAAATAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929115369_929115373 | 26 | Left | 929115369 | 2:38439432-38439454 | CCACAACACTCCAACTGGCACTT | No data | ||
Right | 929115373 | 2:38439481-38439503 | CAACACTGCATGTAAAATACTGG | No data | ||||
929115368_929115373 | 27 | Left | 929115368 | 2:38439431-38439453 | CCCACAACACTCCAACTGGCACT | No data | ||
Right | 929115373 | 2:38439481-38439503 | CAACACTGCATGTAAAATACTGG | No data | ||||
929115370_929115373 | 16 | Left | 929115370 | 2:38439442-38439464 | CCAACTGGCACTTTCAGCTGCTT | No data | ||
Right | 929115373 | 2:38439481-38439503 | CAACACTGCATGTAAAATACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929115373 | Original CRISPR | CAACACTGCATGTAAAATAC TGG | Intergenic | ||