ID: 929115373

View in Genome Browser
Species Human (GRCh38)
Location 2:38439481-38439503
Sequence CAACACTGCATGTAAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929115369_929115373 26 Left 929115369 2:38439432-38439454 CCACAACACTCCAACTGGCACTT No data
Right 929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG No data
929115368_929115373 27 Left 929115368 2:38439431-38439453 CCCACAACACTCCAACTGGCACT No data
Right 929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG No data
929115370_929115373 16 Left 929115370 2:38439442-38439464 CCAACTGGCACTTTCAGCTGCTT No data
Right 929115373 2:38439481-38439503 CAACACTGCATGTAAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929115373 Original CRISPR CAACACTGCATGTAAAATAC TGG Intergenic