ID: 929118520

View in Genome Browser
Species Human (GRCh38)
Location 2:38465032-38465054
Sequence ATTTACATGGGGCATTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929118520_929118526 14 Left 929118520 2:38465032-38465054 CCATGTAAATGCCCCATGTAAAT No data
Right 929118526 2:38465069-38465091 ACTAACGAAGCAGTGTCCTCTGG No data
929118520_929118524 -9 Left 929118520 2:38465032-38465054 CCATGTAAATGCCCCATGTAAAT No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929118520 Original CRISPR ATTTACATGGGGCATTTACA TGG (reversed) Intergenic
No off target data available for this crispr